Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0302819004:

Variant ID: vg0302819004 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 2819004
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


GAGGAAACATCCGGGAAGTTCCAGAATAAAATCTTGGCAATTGCCTGCTGATGTCATTTGGTGTCTTCAACAGTTCAACTACTAATCGAACGGATGGTGG[G/A]
AAAAACTCAAAAACTTGGTAAATAGATCTTAATTAGAAAAATTGTACCTGTGTTAGTACGTTTATGGGTTTATACTAGGGGTGGATGTCGAGCTGGCTCA

Reverse complement sequence

TGAGCCAGCTCGACATCCACCCCTAGTATAAACCCATAAACGTACTAACACAGGTACAATTTTTCTAATTAAGATCTATTTACCAAGTTTTTGAGTTTTT[C/T]
CCACCATCCGTTCGATTAGTAGTTGAACTGTTGAAGACACCAAATGACATCAGCAGGCAATTGCCAAGATTTTATTCTGGAACTTCCCGGATGTTTCCTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.20% 30.60% 1.21% 0.00% NA
All Indica  2759 97.80% 2.20% 0.04% 0.00% NA
All Japonica  1512 10.00% 86.40% 3.57% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 94.80% 5.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 95.70% 4.20% 0.13% 0.00% NA
Temperate Japonica  767 17.10% 76.50% 6.39% 0.00% NA
Tropical Japonica  504 2.00% 97.40% 0.60% 0.00% NA
Japonica Intermediate  241 4.10% 95.00% 0.83% 0.00% NA
VI/Aromatic  96 60.40% 39.60% 0.00% 0.00% NA
Intermediate  90 55.60% 42.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0302819004 G -> A LOC_Os03g05650.1 missense_variant ; p.Gly3Glu; MODERATE nonsynonymous_codon ; G3E Average:54.284; most accessible tissue: Callus, score: 73.47 unknown unknown DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0302819004 NA 5.31E-13 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302819004 7.38E-06 2.51E-21 mr1062 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302819004 NA 1.28E-08 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302819004 NA 3.81E-44 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302819004 NA 2.46E-10 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302819004 NA 8.43E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302819004 NA 3.90E-08 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302819004 NA 4.85E-13 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302819004 NA 1.86E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302819004 NA 5.95E-13 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302819004 NA 1.10E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302819004 NA 1.05E-17 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302819004 NA 9.75E-30 mr1922 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302819004 NA 2.12E-15 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302819004 NA 4.48E-20 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302819004 NA 6.86E-34 mr1631_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302819004 NA 2.33E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302819004 NA 8.33E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251