\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0302782590:

Variant ID: vg0302782590 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 2782590
Reference Allele: AAlternative Allele: G,C
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.06, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


CCGTGCCCACGGTCATGGGCGGATGTGAGGTGATTCCTAGCGTAGTTTTGTTTGACTACTGCTTTGTGAAATTGCTGCTGTGGAATGGGTTCGATGTTTG[A/G,C]
AAAATCGGCGGCTGATGGGATCAGTCAGGCCCGGGTGGCCGTTTGAAAGTTGTTGGCTGGTGCCAACCTTGGATCAATTCAAAAGACTGATACATTGCAC

Reverse complement sequence

GTGCAATGTATCAGTCTTTTGAATTGATCCAAGGTTGGCACCAGCCAACAACTTTCAAACGGCCACCCGGGCCTGACTGATCCCATCAGCCGCCGATTTT[T/C,G]
CAAACATCGAACCCATTCCACAGCAGCAATTTCACAAAGCAGTAGTCAAACAAAACTACGCTAGGAATCACCTCACATCCGCCCATGACCGTGGGCACGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.90% 35.70% 23.83% 2.56% C: 0.02%
All Indica  2759 6.70% 53.10% 36.32% 3.84% C: 0.04%
All Japonica  1512 98.00% 0.30% 0.93% 0.73% NA
Aus  269 11.20% 58.70% 30.11% 0.00% NA
Indica I  595 2.50% 72.90% 23.53% 1.01% NA
Indica II  465 11.00% 21.10% 58.28% 9.46% C: 0.22%
Indica III  913 4.40% 61.30% 30.67% 3.61% NA
Indica Intermediate  786 10.20% 47.30% 39.57% 2.93% NA
Temperate Japonica  767 99.20% 0.30% 0.52% 0.00% NA
Tropical Japonica  504 99.40% 0.40% 0.00% 0.20% NA
Japonica Intermediate  241 91.30% 0.40% 4.15% 4.15% NA
VI/Aromatic  96 46.90% 37.50% 14.58% 1.04% NA
Intermediate  90 52.20% 27.80% 16.67% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0302782590 A -> C LOC_Os03g05570.1 upstream_gene_variant ; 4821.0bp to feature; MODIFIER silent_mutation Average:11.852; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0302782590 A -> C LOC_Os03g05570-LOC_Os03g05580 intergenic_region ; MODIFIER silent_mutation Average:11.852; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0302782590 A -> DEL N N silent_mutation Average:11.852; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0302782590 A -> G LOC_Os03g05570.1 upstream_gene_variant ; 4821.0bp to feature; MODIFIER silent_mutation Average:11.852; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0302782590 A -> G LOC_Os03g05570-LOC_Os03g05580 intergenic_region ; MODIFIER silent_mutation Average:11.852; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0302782590 NA 4.47E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590 NA 6.99E-08 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590 NA 5.89E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590 NA 2.17E-19 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590 NA 3.82E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590 NA 3.80E-13 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590 NA 1.13E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590 NA 1.88E-28 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590 NA 2.01E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590 7.60E-07 1.59E-49 mr1519_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590 6.80E-06 NA mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590 NA 5.40E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590 NA 5.97E-32 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590 NA 1.20E-24 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590 NA 8.26E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251