Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0302782590:

Variant ID: vg0302782590 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 2782590
Reference Allele: A	Alternative Allele: G,C
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.06, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:

CCGTGCCCACGGTCATGGGCGGATGTGAGGTGATTCCTAGCGTAGTTTTGTTTGACTACTGCTTTGTGAAATTGCTGCTGTGGAATGGGTTCGATGTTTG[A/G,C]
AAAATCGGCGGCTGATGGGATCAGTCAGGCCCGGGTGGCCGTTTGAAAGTTGTTGGCTGGTGCCAACCTTGGATCAATTCAAAAGACTGATACATTGCAC

Reverse complement sequence

GTGCAATGTATCAGTCTTTTGAATTGATCCAAGGTTGGCACCAGCCAACAACTTTCAAACGGCCACCCGGGCCTGACTGATCCCATCAGCCGCCGATTTT[T/C,G]
CAAACATCGAACCCATTCCACAGCAGCAATTTCACAAAGCAGTAGTCAAACAAAACTACGCTAGGAATCACCTCACATCCGCCCATGACCGTGGGCACGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.90%	35.70%	23.83%	2.56%	C: 0.02%
All Indica	2759	6.70%	53.10%	36.32%	3.84%	C: 0.04%
All Japonica	1512	98.00%	0.30%	0.93%	0.73%	NA
Aus	269	11.20%	58.70%	30.11%	0.00%	NA
Indica I	595	2.50%	72.90%	23.53%	1.01%	NA
Indica II	465	11.00%	21.10%	58.28%	9.46%	C: 0.22%
Indica III	913	4.40%	61.30%	30.67%	3.61%	NA
Indica Intermediate	786	10.20%	47.30%	39.57%	2.93%	NA
Temperate Japonica	767	99.20%	0.30%	0.52%	0.00%	NA
Tropical Japonica	504	99.40%	0.40%	0.00%	0.20%	NA
Japonica Intermediate	241	91.30%	0.40%	4.15%	4.15%	NA
VI/Aromatic	96	46.90%	37.50%	14.58%	1.04%	NA
Intermediate	90	52.20%	27.80%	16.67%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0302782590	A -> C	LOC_Os03g05570.1	upstream_gene_variant ; 4821.0bp to feature; MODIFIER	silent_mutation	Average:11.852; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0302782590	A -> C	LOC_Os03g05570-LOC_Os03g05580	intergenic_region ; MODIFIER	silent_mutation	Average:11.852; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0302782590	A -> DEL	N	N	silent_mutation	Average:11.852; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0302782590	A -> G	LOC_Os03g05570.1	upstream_gene_variant ; 4821.0bp to feature; MODIFIER	silent_mutation	Average:11.852; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0302782590	A -> G	LOC_Os03g05570-LOC_Os03g05580	intergenic_region ; MODIFIER	silent_mutation	Average:11.852; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0302782590	NA	4.47E-11	mr1172	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590	NA	6.99E-08	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590	NA	5.89E-08	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590	NA	2.17E-19	mr1529	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590	NA	3.82E-12	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590	NA	3.80E-13	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590	NA	1.13E-14	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590	NA	1.88E-28	mr1723	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590	NA	2.01E-13	mr1924	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590	7.60E-07	1.59E-49	mr1519_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590	6.80E-06	NA	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590	NA	5.40E-07	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590	NA	5.97E-32	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590	NA	1.20E-24	mr1708_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302782590	NA	8.26E-08	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251