\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0302286989:

Variant ID: vg0302286989 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 2286989
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCGTGCTGCACGGCGCTGGTTGATCGTGTCGTGAAGGTCGACGGGACGCCGGTGAGGTGGAGAGCGAGGCCGTTTGACTCGGCGCTCCCTGTGACGTTC[A/G]
GGAGGCGAGTGAACAGATCGTTTGTCGTGACCCCTGCTCCTGCGACTAGATCCTGTGCCGATGATGCTGAGGCTTGGCTGATGATAATCATGAGATCGGA

Reverse complement sequence

TCCGATCTCATGATTATCATCAGCCAAGCCTCAGCATCATCGGCACAGGATCTAGTCGCAGGAGCAGGGGTCACGACAAACGATCTGTTCACTCGCCTCC[T/C]
GAACGTCACAGGGAGCGCCGAGTCAAACGGCCTCGCTCTCCACCTCACCGGCGTCCCGTCGACCTTCACGACACGATCAACCAGCGCCGTGCAGCACGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.20% 23.10% 10.64% 0.06% NA
All Indica  2759 81.10% 4.00% 14.79% 0.11% NA
All Japonica  1512 36.60% 60.60% 2.78% 0.00% NA
Aus  269 82.90% 4.80% 12.27% 0.00% NA
Indica I  595 73.60% 3.90% 22.52% 0.00% NA
Indica II  465 91.80% 1.50% 6.24% 0.43% NA
Indica III  913 81.20% 4.90% 13.91% 0.00% NA
Indica Intermediate  786 80.40% 4.50% 15.01% 0.13% NA
Temperate Japonica  767 60.20% 35.30% 4.43% 0.00% NA
Tropical Japonica  504 7.70% 91.50% 0.79% 0.00% NA
Japonica Intermediate  241 22.00% 76.30% 1.66% 0.00% NA
VI/Aromatic  96 59.40% 30.20% 10.42% 0.00% NA
Intermediate  90 63.30% 25.60% 11.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0302286989 A -> DEL LOC_Os03g04810.1 N frameshift_variant Average:18.534; most accessible tissue: Callus, score: 27.444 N N N N
vg0302286989 A -> G LOC_Os03g04810.1 synonymous_variant ; p.Pro350Pro; LOW synonymous_codon Average:18.534; most accessible tissue: Callus, score: 27.444 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0302286989 NA 6.46E-16 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0302286989 NA 8.77E-08 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286989 NA 5.21E-09 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286989 NA 4.05E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286989 NA 7.63E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286989 NA 3.16E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286989 NA 2.72E-11 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286989 NA 1.78E-11 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286989 2.51E-06 NA mr1011_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286989 NA 2.98E-08 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286989 NA 5.98E-06 mr1154_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286989 NA 4.60E-08 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286989 NA 6.65E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286989 NA 7.17E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286989 NA 1.67E-07 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286989 NA 7.35E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286989 NA 9.78E-08 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286989 NA 2.28E-10 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286989 NA 2.81E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286989 NA 6.68E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251