Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0302286724:

Variant ID: vg0302286724 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 2286724
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

CCATGGGGCACTCCGTGGAGCCAGGATCGGGCGGAATCCGCTAGGGCCACAGGTAGATAGTTTGCTATGGCCTTGCTGTCTCCTCCTGCTGCGCGGATTG[T/C]
GAGTCCGTAGACGGTGAGCCAAGACTTCGGATTAGTGGTGCCGTCATACTTCTCGATTCCAGTCAGCTTAAAGCCGGCTGGCCAATCCACTCGACGCAGG

Reverse complement sequence

CCTGCGTCGAGTGGATTGGCCAGCCGGCTTTAAGCTGACTGGAATCGAGAAGTATGACGGCACCACTAATCCGAAGTCTTGGCTCACCGTCTACGGACTC[A/G]
CAATCCGCGCAGCAGGAGGAGACAGCAAGGCCATAGCAAACTATCTACCTGTGGCCCTAGCGGATTCCGCCCGATCCTGGCTCCACGGAGTGCCCCATGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.00%	21.50%	9.54%	0.00%	NA
All Indica	2759	51.00%	33.20%	15.84%	0.00%	NA
All Japonica	1512	99.80%	0.10%	0.07%	0.00%	NA
Aus	269	71.00%	25.30%	3.72%	0.00%	NA
Indica I	595	16.60%	46.40%	36.97%	0.00%	NA
Indica II	465	83.20%	12.70%	4.09%	0.00%	NA
Indica III	913	53.30%	37.50%	9.20%	0.00%	NA
Indica Intermediate	786	55.20%	30.30%	14.50%	0.00%	NA
Temperate Japonica	767	99.70%	0.10%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	78.10%	20.80%	1.04%	0.00%	NA
Intermediate	90	85.60%	12.20%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0302286724	T -> C	LOC_Os03g04810.1	missense_variant ; p.Thr439Ala; MODERATE	nonsynonymous_codon ; T439A	Average:22.983; most accessible tissue: Callus, score: 32.831	benign	-0.577	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0302286724	NA	2.11E-07	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286724	NA	2.37E-06	mr1531	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286724	NA	2.96E-08	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286724	NA	1.31E-06	mr1127_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286724	NA	3.36E-07	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286724	NA	3.15E-07	mr1169_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286724	NA	5.78E-09	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286724	NA	1.71E-07	mr1347_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286724	NA	5.12E-06	mr1406_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286724	NA	1.15E-06	mr1510_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286724	NA	2.92E-06	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286724	NA	1.14E-06	mr1592_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286724	7.96E-07	5.05E-08	mr1594_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286724	9.26E-06	2.55E-07	mr1612_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286724	NA	6.25E-10	mr1659_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286724	NA	2.24E-06	mr1714_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286724	NA	4.28E-06	mr1806_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286724	NA	1.10E-06	mr1895_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302286724	NA	4.83E-06	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251