Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0302258917:

Variant ID: vg0302258917 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 2258917
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

TGGATTCAATTCCCCAAACAGGAATAGGGTATTACCTCTCATTGAGAGGGTCTGAACCTGTCTAAATCCCTGTCTCTGCATCCATCCACTTTTAGGTCTC[G/A]
TACGCTACCTCCTTTTCATATTGCCGAAAATTTGTTTCGACAAAAACACAATCAGTAATCTTTTTCAGCAAAAGGTCATCGGCAGTTTTGATGCACTGCA

Reverse complement sequence

TGCAGTGCATCAAAACTGCCGATGACCTTTTGCTGAAAAAGATTACTGATTGTGTTTTTGTCGAAACAAATTTTCGGCAATATGAAAAGGAGGTAGCGTA[C/T]
GAGACCTAAAAGTGGATGGATGCAGAGACAGGGATTTAGACAGGTTCAGACCCTCTCAATGAGAGGTAATACCCTATTCCTGTTTGGGGAATTGAATCCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.20%	32.50%	0.00%	0.36%	NA
All Indica	2759	47.90%	51.50%	0.00%	0.62%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	70.60%	29.40%	0.00%	0.00%	NA
Indica I	595	13.80%	85.70%	0.00%	0.50%	NA
Indica II	465	82.60%	17.20%	0.00%	0.22%	NA
Indica III	913	47.20%	52.10%	0.00%	0.66%	NA
Indica Intermediate	786	53.90%	45.20%	0.00%	0.89%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	82.30%	17.70%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0302258917	G -> A	LOC_Os03g04740.1	upstream_gene_variant ; 1880.0bp to feature; MODIFIER	silent_mutation	Average:69.269; most accessible tissue: Minghui63 flower, score: 91.059	N	N	N	N
vg0302258917	G -> A	LOC_Os03g04720.1	downstream_gene_variant ; 3498.0bp to feature; MODIFIER	silent_mutation	Average:69.269; most accessible tissue: Minghui63 flower, score: 91.059	N	N	N	N
vg0302258917	G -> A	LOC_Os03g04720-LOC_Os03g04740	intergenic_region ; MODIFIER	silent_mutation	Average:69.269; most accessible tissue: Minghui63 flower, score: 91.059	N	N	N	N
vg0302258917	G -> DEL	N	N	silent_mutation	Average:69.269; most accessible tissue: Minghui63 flower, score: 91.059	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0302258917	G	A	-0.05	-0.01	0.0	-0.01	-0.02	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0302258917	NA	8.11E-08	mr1174	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302258917	NA	8.94E-06	mr1531	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302258917	NA	1.90E-07	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302258917	NA	1.39E-08	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302258917	NA	4.39E-06	mr1169_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302258917	NA	7.54E-13	mr1174_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302258917	NA	5.70E-10	mr1347_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302258917	NA	2.32E-06	mr1612_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302258917	NA	4.19E-07	mr1659_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302258917	NA	3.00E-07	mr1895_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302258917	NA	1.97E-06	mr1923_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302258917	NA	2.20E-06	mr1933_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251