\
| Variant ID: vg0302254076 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 2254076 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 124. )
TTGGTCACACCACCGTTCATGGGCGTCCACGTCTTCACCGACCGGCTGGCCTTTGCCGCCGCCGACTGGTGTTTCCGCCTGTACGGCTGGCCTATTATGC[C/T]
GCCACTGTTGGGCGTCTACGACTTCACCGCCGGCCTGCCTTTGCCGCCACTGACTGGTGTTTTCGCCTATACGGTTGGCGGACTCCGCCGCCGTTAATGG
CCATTAACGGCGGCGGAGTCCGCCAACCGTATAGGCGAAAACACCAGTCAGTGGCGGCAAAGGCAGGCCGGCGGTGAAGTCGTAGACGCCCAACAGTGGC[G/A]
GCATAATAGGCCAGCCGTACAGGCGGAAACACCAGTCGGCGGCGGCAAAGGCCAGCCGGTCGGTGAAGACGTGGACGCCCATGAACGGTGGTGTGACCAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.80% | 18.40% | 5.08% | 8.80% | NA |
| All Indica | 2759 | 54.10% | 24.70% | 7.61% | 13.56% | NA |
| All Japonica | 1512 | 99.50% | 0.30% | 0.07% | 0.07% | NA |
| Aus | 269 | 32.30% | 49.40% | 7.06% | 11.15% | NA |
| Indica I | 595 | 86.70% | 6.10% | 3.53% | 3.70% | NA |
| Indica II | 465 | 22.20% | 35.30% | 16.13% | 26.45% | NA |
| Indica III | 913 | 53.10% | 29.70% | 4.49% | 12.71% | NA |
| Indica Intermediate | 786 | 49.50% | 26.80% | 9.29% | 14.38% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 0.80% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 60.40% | 31.20% | 5.21% | 3.12% | NA |
| Intermediate | 90 | 65.60% | 20.00% | 5.56% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0302254076 | C -> T | LOC_Os03g04710.1 | downstream_gene_variant ; 3356.0bp to feature; MODIFIER | silent_mutation | Average:56.803; most accessible tissue: Zhenshan97 flag leaf, score: 81.212 | N | N | N | N |
| vg0302254076 | C -> T | LOC_Os03g04710.2 | downstream_gene_variant ; 3356.0bp to feature; MODIFIER | silent_mutation | Average:56.803; most accessible tissue: Zhenshan97 flag leaf, score: 81.212 | N | N | N | N |
| vg0302254076 | C -> T | LOC_Os03g04720.1 | intron_variant ; MODIFIER | silent_mutation | Average:56.803; most accessible tissue: Zhenshan97 flag leaf, score: 81.212 | N | N | N | N |
| vg0302254076 | C -> DEL | N | N | silent_mutation | Average:56.803; most accessible tissue: Zhenshan97 flag leaf, score: 81.212 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0302254076 | NA | 5.80E-19 | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0302254076 | NA | 2.80E-07 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0302254076 | NA | 1.21E-08 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0302254076 | NA | 2.29E-08 | mr1174_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0302254076 | NA | 6.04E-07 | mr1347_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0302254076 | 4.03E-06 | 7.15E-08 | mr1612_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0302254076 | NA | 1.38E-07 | mr1659_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0302254076 | NA | 3.77E-16 | mr1715_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |