Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0302254076:

Variant ID: vg0302254076 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 2254076
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

TTGGTCACACCACCGTTCATGGGCGTCCACGTCTTCACCGACCGGCTGGCCTTTGCCGCCGCCGACTGGTGTTTCCGCCTGTACGGCTGGCCTATTATGC[C/T]
GCCACTGTTGGGCGTCTACGACTTCACCGCCGGCCTGCCTTTGCCGCCACTGACTGGTGTTTTCGCCTATACGGTTGGCGGACTCCGCCGCCGTTAATGG

Reverse complement sequence

CCATTAACGGCGGCGGAGTCCGCCAACCGTATAGGCGAAAACACCAGTCAGTGGCGGCAAAGGCAGGCCGGCGGTGAAGTCGTAGACGCCCAACAGTGGC[G/A]
GCATAATAGGCCAGCCGTACAGGCGGAAACACCAGTCGGCGGCGGCAAAGGCCAGCCGGTCGGTGAAGACGTGGACGCCCATGAACGGTGGTGTGACCAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.80%	18.40%	5.08%	8.80%	NA
All Indica	2759	54.10%	24.70%	7.61%	13.56%	NA
All Japonica	1512	99.50%	0.30%	0.07%	0.07%	NA
Aus	269	32.30%	49.40%	7.06%	11.15%	NA
Indica I	595	86.70%	6.10%	3.53%	3.70%	NA
Indica II	465	22.20%	35.30%	16.13%	26.45%	NA
Indica III	913	53.10%	29.70%	4.49%	12.71%	NA
Indica Intermediate	786	49.50%	26.80%	9.29%	14.38%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	0.80%	0.20%	0.20%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	60.40%	31.20%	5.21%	3.12%	NA
Intermediate	90	65.60%	20.00%	5.56%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0302254076	C -> T	LOC_Os03g04710.1	downstream_gene_variant ; 3356.0bp to feature; MODIFIER	silent_mutation	Average:56.803; most accessible tissue: Zhenshan97 flag leaf, score: 81.212	N	N	N	N
vg0302254076	C -> T	LOC_Os03g04710.2	downstream_gene_variant ; 3356.0bp to feature; MODIFIER	silent_mutation	Average:56.803; most accessible tissue: Zhenshan97 flag leaf, score: 81.212	N	N	N	N
vg0302254076	C -> T	LOC_Os03g04720.1	intron_variant ; MODIFIER	silent_mutation	Average:56.803; most accessible tissue: Zhenshan97 flag leaf, score: 81.212	N	N	N	N
vg0302254076	C -> DEL	N	N	silent_mutation	Average:56.803; most accessible tissue: Zhenshan97 flag leaf, score: 81.212	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0302254076	NA	5.80E-19	mr1557	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302254076	NA	2.80E-07	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302254076	NA	1.21E-08	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302254076	NA	2.29E-08	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302254076	NA	6.04E-07	mr1347_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302254076	4.03E-06	7.15E-08	mr1612_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302254076	NA	1.38E-07	mr1659_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0302254076	NA	3.77E-16	mr1715_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251