RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0301975407:

Variant ID: vg0301975407 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 1975407
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 130. )

Flanking Sequence (100 bp) in Reference Genome:

AGCACTTATGGCTAATCATGGACTAATTAGGCTCAAAAGATTCGTCTCGCGATATCCATGCAAACTGTGCAATTAGTTTTTGTTTTTATCTATATTTAAT[G/A]
CTCCATGCATGTATCCAAAGATTTGATGTGACGTTTTTGGGGGAAAAAAATTTTGAGAACTAAACCAAGCCTGAATAGATTCATACGGTTTTGTTGAAAA

Reverse complement sequence

TTTTCAACAAAACCGTATGAATCTATTCAGGCTTGGTTTAGTTCTCAAAATTTTTTTCCCCCAAAAACGTCACATCAAATCTTTGGATACATGCATGGAG[C/T]
ATTAAATATAGATAAAAACAAAAACTAATTGCACAGTTTGCATGGATATCGCGAGACGAATCTTTTGAGCCTAATTAGTCCATGATTAGCCATAAGTGCT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.00%	5.00%	0.04%	0.00%	NA
All Indica	2759	91.50%	8.40%	0.07%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	73.40%	26.60%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.70%	0.10%	0.22%	0.00%	NA
Indica Intermediate	786	90.70%	9.30%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0301975407	G -> A	LOC_Os03g04300.3	downstream_gene_variant ; 780.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0301975407	G -> A	LOC_Os03g04300.2	downstream_gene_variant ; 804.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0301975407	G -> A	LOC_Os03g04300.1	intron_variant ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0301975407	NA	5.26E-06	mr1533	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301975407	NA	4.54E-06	mr1980	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301975407	6.07E-06	1.10E-08	mr1533_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 3 of 3 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0301975407:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact