\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0301900951:

Variant ID: vg0301900951 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 1900951
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.01, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:


TAGCCCTTTCAGCCACCCAAGCTTGAGATGCCATCTTCCCAAGAACTCTGCTTCTTGAAGCACAATGATGATCCTCCTCATTTATTTGGATCTGCACAAG[T/C]
AAACCATATTAGCAACTTATTAGGTAAACAAAATCAATGCATACAGCATAATGTACAATTTAACAACAATTAAATAGTTAGTATAATACCCTGACACTTT

Reverse complement sequence

AAAGTGTCAGGGTATTATACTAACTATTTAATTGTTGTTAAATTGTACATTATGCTGTATGCATTGATTTTGTTTACCTAATAAGTTGCTAATATGGTTT[A/G]
CTTGTGCAGATCCAAATAAATGAGGAGGATCATCATTGTGCTTCAAGAAGCAGAGTTCTTGGGAAGATGGCATCTCAAGCTTGGGTGGCTGAAAGGGCTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.30% 6.60% 5.95% 10.20% NA
All Indica  2759 77.90% 0.30% 7.94% 13.88% NA
All Japonica  1512 73.50% 17.00% 3.37% 6.15% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 92.80% 0.00% 3.70% 3.53% NA
Indica II  465 56.80% 0.90% 16.56% 25.81% NA
Indica III  913 73.80% 0.10% 8.32% 17.74% NA
Indica Intermediate  786 84.00% 0.30% 5.60% 10.18% NA
Temperate Japonica  767 95.00% 0.30% 1.69% 3.00% NA
Tropical Japonica  504 49.80% 44.60% 3.57% 1.98% NA
Japonica Intermediate  241 54.40% 12.40% 8.30% 24.90% NA
VI/Aromatic  96 50.00% 41.70% 6.25% 2.08% NA
Intermediate  90 83.30% 6.70% 5.56% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0301900951 T -> C LOC_Os03g04140.1 upstream_gene_variant ; 3642.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301900951 T -> C LOC_Os03g04140.2 upstream_gene_variant ; 3642.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301900951 T -> C LOC_Os03g04150.1 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301900951 T -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0301900951 NA 1.27E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301900951 NA 2.57E-08 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301900951 7.01E-07 9.91E-09 mr1929_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251