Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0301533591:

Variant ID: vg0301533591 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 1533591
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

TCTAGTTCGCAAACTAAGGGCCCCTTTGAATCAAAGGAATGAAAAAACGGAGGAATAGGAAAAACATATGATTCTGACAGGAATGTAAGTGTAAAACAGA[G/T]
GATTGCAAACCACAGGAAAAACATAGGAATGACCGTTTGATTGGACCACAGGAAAAACACAGGAATTTGAGGAGAGATAAAGACTCGAAGGATTTCTTCC

Reverse complement sequence

GGAAGAAATCCTTCGAGTCTTTATCTCTCCTCAAATTCCTGTGTTTTTCCTGTGGTCCAATCAAACGGTCATTCCTATGTTTTTCCTGTGGTTTGCAATC[C/A]
TCTGTTTTACACTTACATTCCTGTCAGAATCATATGTTTTTCCTATTCCTCCGTTTTTTCATTCCTTTGATTCAAAGGGGCCCTTAGTTTGCGAACTAGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.70%	36.30%	0.93%	0.00%	NA
All Indica	2759	97.40%	2.30%	0.29%	0.00%	NA
All Japonica	1512	0.40%	99.30%	0.33%	0.00%	NA
Aus	269	71.00%	21.60%	7.43%	0.00%	NA
Indica I	595	97.80%	2.20%	0.00%	0.00%	NA
Indica II	465	93.80%	6.00%	0.22%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	96.40%	2.70%	0.89%	0.00%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	0.40%	99.00%	0.60%	0.00%	NA
Japonica Intermediate	241	0.40%	98.80%	0.83%	0.00%	NA
VI/Aromatic	96	38.50%	55.20%	6.25%	0.00%	NA
Intermediate	90	48.90%	45.60%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0301533591	G -> T	LOC_Os03g03540.1	upstream_gene_variant ; 1967.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0301533591	G -> T	LOC_Os03g03540-LOC_Os03g03550	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0301533591	NA	2.57E-54	mr1141_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301533591	NA	8.78E-22	mr1175_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301533591	NA	3.45E-18	mr1199_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301533591	NA	6.81E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301533591	NA	2.28E-38	mr1251_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301533591	NA	1.43E-20	mr1253_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301533591	NA	1.92E-08	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301533591	NA	8.22E-13	mr1377_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301533591	NA	1.32E-38	mr1435_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301533591	NA	7.73E-06	mr1521_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301533591	NA	1.51E-06	mr1567_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301533591	NA	4.60E-09	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301533591	NA	6.75E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301533591	NA	6.01E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301533591	NA	1.20E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301533591	NA	1.36E-09	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301533591	NA	7.13E-06	mr1901_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301533591	NA	1.13E-07	mr1915_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301533591	NA	3.62E-17	mr1938_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301533591	NA	3.52E-18	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251