\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0301511076:

Variant ID: vg0301511076 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 1511076
Reference Allele: AAlternative Allele: ACACTGGACAGCAGGGGCAGCGAGCGAT,ACACTGGACAGCAAGGGCAGCGAGCGAT,G,AGCGAT
Primary Allele: ACACTGGACAGCAGGGGCAG CGAGCGATSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCATACCAATCGAGACGTTTTGTTTGATGTCGCAACAATAGTAGCCCGGCTCATGTTCTCCCCTGTTGGATGTTTGCACATGAACATGCTCTGCTTAGCG[A/ACACTGGACAGCAGGGGCAGCGAGCGAT,ACACTGGACAGCAAGGGCAGCGAGCGAT,G,AGCGAT]
TGCCTTGGGGAGTTGGGATTTTTGGCGATGTGGGTTTCGTACACCGGCAGGTGACGGGTCGTGTCCACCCGATCGTATACCGTCACCAGCACGTCCGCGT

Reverse complement sequence

ACGCGGACGTGCTGGTGACGGTATACGATCGGGTGGACACGACCCGTCACCTGCCGGTGTACGAAACCCACATCGCCAAAAATCCCAACTCCCCAAGGCA[T/ATCGCTCGCTGCCCCTGCTGTCCAGTGT,ATCGCTCGCTGCCCTTGCTGTCCAGTGT,C,ATCGCT]
CGCTAAGCAGAGCATGTTCATGTGCAAACATCCAACAGGGGAGAACATGAGCCGGGCTACTATTGTTGCGACATCAAACAAAACGTCTCGATTGGTATGA

Allele Frequencies:

Populations Population SizeFrequency of ACACTGGACAGCAGGGGCAG CGAGCGAT(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.00% 16.00% 0.11% 0.00% ACACTGGACAGCAAGGGCAGCGAGCGAT: 2.33%; G: 0.53%; AGCGAT: 0.04%
All Indica  2759 95.70% 1.30% 0.11% 0.00% ACACTGGACAGCAAGGGCAGCGAGCGAT: 2.28%; G: 0.62%; AGCGAT: 0.07%
All Japonica  1512 52.70% 46.60% 0.00% 0.00% ACACTGGACAGCAAGGGCAGCGAGCGAT: 0.40%; G: 0.33%
Aus  269 87.40% 0.00% 0.00% 0.00% ACACTGGACAGCAAGGGCAGCGAGCGAT: 11.52%; G: 1.12%
Indica I  595 91.60% 0.20% 0.50% 0.00% ACACTGGACAGCAAGGGCAGCGAGCGAT: 7.06%; G: 0.67%
Indica II  465 93.30% 5.40% 0.00% 0.00% G: 1.29%
Indica III  913 99.60% 0.10% 0.00% 0.00% AGCGAT: 0.22%; G: 0.11%
Indica Intermediate  786 95.50% 1.00% 0.00% 0.00% ACACTGGACAGCAAGGGCAGCGAGCGAT: 2.67%; G: 0.76%
Temperate Japonica  767 34.80% 64.80% 0.00% 0.00% G: 0.39%
Tropical Japonica  504 79.20% 19.80% 0.00% 0.00% ACACTGGACAGCAAGGGCAGCGAGCGAT: 0.60%; G: 0.40%
Japonica Intermediate  241 54.40% 44.40% 0.00% 0.00% ACACTGGACAGCAAGGGCAGCGAGCGAT: 1.24%
VI/Aromatic  96 94.80% 0.00% 0.00% 0.00% ACACTGGACAGCAAGGGCAGCGAGCGAT: 5.21%
Intermediate  90 73.30% 18.90% 2.22% 0.00% ACACTGGACAGCAAGGGCAGCGAGCGAT: 5.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0301511076 A -> ACACTGGACAGCAGGGGCAGCGAGCGAT LOC_Os03g03500.1 upstream_gene_variant ; 245.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301511076 A -> ACACTGGACAGCAGGGGCAGCGAGCGAT LOC_Os03g03490.1 downstream_gene_variant ; 1395.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301511076 A -> ACACTGGACAGCAGGGGCAGCGAGCGAT LOC_Os03g03510.1 downstream_gene_variant ; 3545.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301511076 A -> ACACTGGACAGCAGGGGCAGCGAGCGAT LOC_Os03g03510.2 downstream_gene_variant ; 3545.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301511076 A -> ACACTGGACAGCAGGGGCAGCGAGCGAT LOC_Os03g03490-LOC_Os03g03500 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301511076 A -> AGCGAT LOC_Os03g03500.1 upstream_gene_variant ; 245.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301511076 A -> AGCGAT LOC_Os03g03490.1 downstream_gene_variant ; 1395.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301511076 A -> AGCGAT LOC_Os03g03510.1 downstream_gene_variant ; 3545.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301511076 A -> AGCGAT LOC_Os03g03510.2 downstream_gene_variant ; 3545.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301511076 A -> AGCGAT LOC_Os03g03490-LOC_Os03g03500 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301511076 A -> G LOC_Os03g03500.1 upstream_gene_variant ; 246.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301511076 A -> G LOC_Os03g03490.1 downstream_gene_variant ; 1394.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301511076 A -> G LOC_Os03g03510.1 downstream_gene_variant ; 3546.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301511076 A -> G LOC_Os03g03510.2 downstream_gene_variant ; 3546.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301511076 A -> G LOC_Os03g03490-LOC_Os03g03500 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301511076 A -> ACACTGGACAGCAAGGGCAGCGAGCGAT LOC_Os03g03500.1 upstream_gene_variant ; 245.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301511076 A -> ACACTGGACAGCAAGGGCAGCGAGCGAT LOC_Os03g03490.1 downstream_gene_variant ; 1395.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301511076 A -> ACACTGGACAGCAAGGGCAGCGAGCGAT LOC_Os03g03510.1 downstream_gene_variant ; 3545.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301511076 A -> ACACTGGACAGCAAGGGCAGCGAGCGAT LOC_Os03g03510.2 downstream_gene_variant ; 3545.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301511076 A -> ACACTGGACAGCAAGGGCAGCGAGCGAT LOC_Os03g03490-LOC_Os03g03500 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0301511076 A ACACT* -0.13 0.11 0.07 0.11 0.04 -0.24
vg0301511076 A AGCGA* 0.0 -0.06 -0.4 -0.21 -0.12 -0.19
vg0301511076 A G 0.08 0.04 -0.03 0.05 0.03 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0301511076 NA 1.21E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0301511076 NA 2.80E-16 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0301511076 NA 4.06E-09 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301511076 NA 1.14E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301511076 NA 4.40E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301511076 NA 8.27E-08 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301511076 NA 7.48E-06 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301511076 NA 7.96E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301511076 NA 5.17E-15 mr1002_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301511076 NA 9.67E-10 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301511076 NA 7.65E-08 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301511076 NA 1.78E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301511076 NA 2.39E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301511076 NA 7.77E-06 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301511076 NA 8.45E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301511076 NA 7.74E-09 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301511076 NA 1.24E-08 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301511076 NA 1.12E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301511076 NA 4.07E-10 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301511076 NA 5.78E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301511076 NA 5.20E-11 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301511076 NA 2.69E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251