\
| Variant ID: vg0301371771 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 1371771 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, A: 0.12, others allele: 0.00, population size: 80. )
TCGGGAATGCTTCGCCGAATGCCGGTCGCCACCCGATGATCTCCTTTGCTAGAAGAACGCCGTGCGCCAACATCTCCTTCAGATTATCTTCCGTCACATC[A/G]
GAGGGCGCCCACTGACTCTCGAAGCTTTCTCTTTTTTCCGCCATGAATGTGGACTGGATGGTTTGATTTGGTCCGAGATACGGCTGGAAAGGGATGGGGA
TCCCCATCCCTTTCCAGCCGTATCTCGGACCAAATCAAACCATCCAGTCCACATTCATGGCGGAAAAAAGAGAAAGCTTCGAGAGTCAGTGGGCGCCCTC[T/C]
GATGTGACGGAAGATAATCTGAAGGAGATGTTGGCGCACGGCGTTCTTCTAGCAAAGGAGATCATCGGGTGGCGACCGGCATTCGGCGAAGCATTCCCGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.30% | 12.00% | 9.16% | 50.57% | NA |
| All Indica | 2759 | 4.00% | 2.40% | 11.34% | 82.24% | NA |
| All Japonica | 1512 | 67.90% | 31.70% | 0.20% | 0.26% | NA |
| Aus | 269 | 43.50% | 0.00% | 36.43% | 20.07% | NA |
| Indica I | 595 | 9.20% | 1.00% | 3.53% | 86.22% | NA |
| Indica II | 465 | 0.90% | 6.90% | 9.25% | 83.01% | NA |
| Indica III | 913 | 0.70% | 1.20% | 18.29% | 79.85% | NA |
| Indica Intermediate | 786 | 5.90% | 2.20% | 10.43% | 81.55% | NA |
| Temperate Japonica | 767 | 41.70% | 57.80% | 0.39% | 0.13% | NA |
| Tropical Japonica | 504 | 97.20% | 2.40% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 89.60% | 10.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 54.20% | 1.00% | 11.46% | 33.33% | NA |
| Intermediate | 90 | 35.60% | 21.10% | 8.89% | 34.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0301371771 | A -> DEL | LOC_Os03g03220.1 | N | frameshift_variant | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0301371771 | A -> G | LOC_Os03g03220.1 | synonymous_variant ; p.Ser15Ser; LOW | synonymous_codon | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0301371771 | NA | 4.36E-09 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301371771 | NA | 1.38E-06 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301371771 | NA | 1.17E-06 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301371771 | NA | 3.68E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301371771 | NA | 5.05E-09 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301371771 | NA | 7.49E-07 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301371771 | NA | 5.85E-09 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301371771 | 2.58E-06 | 6.49E-06 | mr1164_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301371771 | NA | 4.71E-07 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301371771 | NA | 5.32E-10 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301371771 | NA | 2.44E-15 | mr1552_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301371771 | NA | 1.49E-06 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301371771 | NA | 2.54E-06 | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301371771 | NA | 1.33E-17 | mr1870_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301371771 | NA | 2.92E-06 | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |