Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0301361367:

Variant ID: vg0301361367 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 1361367
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGTCCGGTCGGAGTATGTGCAATGTGTCAGTCTTTAGATCTTGAAACAAGGTTGGCACCCGGCCAAAAGCTTTTTGAACGGCCACCCGGGCCAACTCTTT[T/C]
CAAACGGCCACCCGGGCCAACAACTTTTAAACTGCCACCCGGGCCTAGCTGATCCCATCAGCTGTAGGTTTTCCAAACATCGAACCCAGTTTCACAACAG

Reverse complement sequence

CTGTTGTGAAACTGGGTTCGATGTTTGGAAAACCTACAGCTGATGGGATCAGCTAGGCCCGGGTGGCAGTTTAAAAGTTGTTGGCCCGGGTGGCCGTTTG[A/G]
AAAGAGTTGGCCCGGGTGGCCGTTCAAAAAGCTTTTGGCCGGGTGCCAACCTTGTTTCAAGATCTAAAGACTGACACATTGCACATACTCCGACCGGACG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.30%	3.90%	1.74%	4.02%	NA
All Indica	2759	91.00%	1.40%	1.59%	5.98%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	33.50%	49.80%	12.27%	4.46%	NA
Indica I	595	93.40%	0.00%	2.02%	4.54%	NA
Indica II	465	81.10%	0.20%	1.08%	17.63%	NA
Indica III	913	95.90%	1.30%	0.77%	1.97%	NA
Indica Intermediate	786	89.20%	3.40%	2.54%	4.83%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	79.20%	7.30%	2.08%	11.46%	NA
Intermediate	90	92.20%	2.20%	3.33%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0301361367	T -> C	LOC_Os03g03210.1	upstream_gene_variant ; 2461.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0301361367	T -> C	LOC_Os03g03200.1	downstream_gene_variant ; 4540.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0301361367	T -> C	LOC_Os03g03200.2	downstream_gene_variant ; 3182.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0301361367	T -> C	LOC_Os03g03200-LOC_Os03g03210	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0301361367	T -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0301361367	NA	5.06E-06	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367	NA	3.96E-07	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367	NA	2.06E-12	mr1231	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367	NA	8.59E-06	mr1287	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367	NA	4.77E-07	mr1314	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367	NA	7.22E-06	mr1331	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367	NA	1.03E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367	NA	3.15E-06	mr1351	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367	NA	3.76E-06	mr1353	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367	NA	1.84E-07	mr1393	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367	NA	3.29E-07	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367	NA	1.30E-06	mr1444	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367	NA	5.73E-06	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367	NA	1.21E-07	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367	NA	4.47E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367	NA	3.51E-07	mr1669	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367	NA	5.53E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367	NA	8.22E-06	mr1791	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367	NA	7.31E-06	mr1820	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367	NA	9.54E-09	mr1939	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251