\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0301361367:

Variant ID: vg0301361367 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 1361367
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTCCGGTCGGAGTATGTGCAATGTGTCAGTCTTTAGATCTTGAAACAAGGTTGGCACCCGGCCAAAAGCTTTTTGAACGGCCACCCGGGCCAACTCTTT[T/C]
CAAACGGCCACCCGGGCCAACAACTTTTAAACTGCCACCCGGGCCTAGCTGATCCCATCAGCTGTAGGTTTTCCAAACATCGAACCCAGTTTCACAACAG

Reverse complement sequence

CTGTTGTGAAACTGGGTTCGATGTTTGGAAAACCTACAGCTGATGGGATCAGCTAGGCCCGGGTGGCAGTTTAAAAGTTGTTGGCCCGGGTGGCCGTTTG[A/G]
AAAGAGTTGGCCCGGGTGGCCGTTCAAAAAGCTTTTGGCCGGGTGCCAACCTTGTTTCAAGATCTAAAGACTGACACATTGCACATACTCCGACCGGACG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.30% 3.90% 1.74% 4.02% NA
All Indica  2759 91.00% 1.40% 1.59% 5.98% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 33.50% 49.80% 12.27% 4.46% NA
Indica I  595 93.40% 0.00% 2.02% 4.54% NA
Indica II  465 81.10% 0.20% 1.08% 17.63% NA
Indica III  913 95.90% 1.30% 0.77% 1.97% NA
Indica Intermediate  786 89.20% 3.40% 2.54% 4.83% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 79.20% 7.30% 2.08% 11.46% NA
Intermediate  90 92.20% 2.20% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0301361367 T -> C LOC_Os03g03210.1 upstream_gene_variant ; 2461.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301361367 T -> C LOC_Os03g03200.1 downstream_gene_variant ; 4540.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301361367 T -> C LOC_Os03g03200.2 downstream_gene_variant ; 3182.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301361367 T -> C LOC_Os03g03200-LOC_Os03g03210 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301361367 T -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0301361367 NA 5.06E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367 NA 3.96E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367 NA 2.06E-12 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367 NA 8.59E-06 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367 NA 4.77E-07 mr1314 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367 NA 7.22E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367 NA 1.03E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367 NA 3.15E-06 mr1351 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367 NA 3.76E-06 mr1353 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367 NA 1.84E-07 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367 NA 3.29E-07 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367 NA 1.30E-06 mr1444 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367 NA 5.73E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367 NA 1.21E-07 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367 NA 4.47E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367 NA 3.51E-07 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367 NA 5.53E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367 NA 8.22E-06 mr1791 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367 NA 7.31E-06 mr1820 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301361367 NA 9.54E-09 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251