\
| Variant ID: vg0301337606 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 1337606 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CATGATTTTGTTTTCGAAGAAAGCTTGATAAAAATCTGATTAGCTTCCACCCACCCCTCGATTTAGAATTAAATTGGGTTTGATCCCTCATGGGGATGTT[C/A]
TCTCATTATTTGCATATAATATATCACTCCACAAACATGCAAGTTCATATTCAACTTCTATATCTTGTAAAAAAACCAAATTTGATTATGAATATACGTT
AACGTATATTCATAATCAAATTTGGTTTTTTTACAAGATATAGAAGTTGAATATGAACTTGCATGTTTGTGGAGTGATATATTATATGCAAATAATGAGA[G/T]
AACATCCCCATGAGGGATCAAACCCAATTTAATTCTAAATCGAGGGGTGGGTGGAAGCTAATCAGATTTTTATCAAGCTTTCTTCGAAAACAAAATCATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.60% | 1.70% | 0.76% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 92.60% | 5.20% | 2.25% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 87.70% | 8.50% | 3.78% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 1.40% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.50% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0301337606 | C -> A | LOC_Os03g03164.2 | upstream_gene_variant ; 2446.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0301337606 | C -> A | LOC_Os03g03164.1 | upstream_gene_variant ; 2461.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0301337606 | C -> A | LOC_Os03g03164.3 | upstream_gene_variant ; 2461.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0301337606 | C -> A | LOC_Os03g03150-LOC_Os03g03164 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0301337606 | NA | 5.70E-07 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301337606 | 9.40E-08 | NA | mr1310_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301337606 | NA | 3.29E-06 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301337606 | 8.38E-06 | NA | mr1900_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301337606 | NA | 1.47E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301337606 | 1.46E-06 | NA | mr1959_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |