\
| Variant ID: vg0301284105 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 1284105 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 272. )
ATCGGCTGAAGGACCGACATCATAAAATCCAAACGATTAGATAAATAGTGAAACCTTTGTTGCAATTGGCTAAATCCAACTTGTGTGTAATCCTTATAAG[C/T]
CGATACAACGTCCAGATAACTCATCAGCTGAAACCCTGATGAAACCCTTGTTGACAATCAAAGGTAGGTTAGTTTTTATGGTTCTAAGCACGACTAAGGT
ACCTTAGTCGTGCTTAGAACCATAAAAACTAACCTACCTTTGATTGTCAACAAGGGTTTCATCAGGGTTTCAGCTGATGAGTTATCTGGACGTTGTATCG[G/A]
CTTATAAGGATTACACACAAGTTGGATTTAGCCAATTGCAACAAAGGTTTCACTATTTATCTAATCGTTTGGATTTTATGATGTCGGTCCTTCAGCCGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.60% | 25.30% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 88.30% | 11.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 46.60% | 53.30% | 0.13% | 0.00% | NA |
| Aus | 269 | 80.70% | 19.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 65.80% | 34.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 84.10% | 15.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 59.60% | 40.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 41.50% | 58.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 15.80% | 83.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0301284105 | C -> T | LOC_Os03g03080-LOC_Os03g03100 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0301284105 | NA | 1.01E-06 | mr1944 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301284105 | NA | 5.49E-06 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301284105 | 5.35E-07 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301284105 | 6.57E-06 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301284105 | NA | 7.43E-08 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301284105 | NA | 1.73E-09 | mr1566_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301284105 | 7.15E-06 | NA | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301284105 | NA | 8.90E-06 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301284105 | 1.44E-06 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301284105 | 7.18E-07 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |