| Variant ID: vg0301280405 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 1280405 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 245. )
ATATGTTTTTTTTTTAAAAAAAGAATGACTATTCTTAATTACACTGTATTCTTTTATGATGATAAAACAACTATTGTTGGTATATCAAAAAGACCAAGGA[C/A]
AAATGCCATAGAAAACGATAAATATGTTATCAAGCAATTTATCTTCAATTACCATGCCCAATAAAGATGAGACTACATCAAGACATGCAAAAGAACATGA
TCATGTTCTTTTGCATGTCTTGATGTAGTCTCATCTTTATTGGGCATGGTAATTGAAGATAAATTGCTTGATAACATATTTATCGTTTTCTATGGCATTT[G/T]
TCCTTGGTCTTTTTGATATACCAACAATAGTTGTTTTATCATCATAAAAGAATACAGTGTAATTAAGAATAGTCATTCTTTTTTTAAAAAAAAAACATAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.00% | 3.70% | 0.36% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 87.80% | 11.00% | 1.12% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.00% | 0.10% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 66.30% | 31.90% | 1.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0301280405 | C -> A | LOC_Os03g03080.1 | downstream_gene_variant ; 3416.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0301280405 | C -> A | LOC_Os03g03080-LOC_Os03g03100 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0301280405 | NA | 2.55E-10 | mr1518 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301280405 | NA | 1.02E-09 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301280405 | NA | 9.88E-13 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301280405 | NA | 5.82E-06 | mr1807 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301280405 | NA | 6.14E-09 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301280405 | NA | 8.44E-11 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0301280405 | NA | 4.59E-14 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |