Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0301209725:

Variant ID: vg0301209725 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 1209725
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGCTGTAAACTTACAGCCGGCTTGAGCACAAGAATCAAGAAACTATGTGAGAGAAACAGGTGGGCCCTGTATTAAATTGTAAAGAGCAAACTATTACTA[C/T]
CTCCGCCCCAAAATATAGCAATTTTTAGTTATGAATCTGAACACAGTTATCCAGATTCATAGCTAAAAATACTTATATTTTAGGACGGAGGGAGTATATG

Reverse complement sequence

CATATACTCCCTCCGTCCTAAAATATAAGTATTTTTAGCTATGAATCTGGATAACTGTGTTCAGATTCATAACTAAAAATTGCTATATTTTGGGGCGGAG[G/A]
TAGTAATAGTTTGCTCTTTACAATTTAATACAGGGCCCACCTGTTTCTCTCACATAGTTTCTTGATTCTTGTGCTCAAGCCGGCTGTAAGTTTACAGCCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.60% 4.70% 0.72% 0.00% NA
All Indica  2759 99.10% 0.80% 0.11% 0.00% NA
All Japonica  1512 97.30% 1.70% 0.99% 0.00% NA
Aus  269 34.60% 59.90% 5.58% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 97.30% 2.30% 0.38% 0.00% NA
Temperate Japonica  767 99.50% 0.00% 0.52% 0.00% NA
Tropical Japonica  504 93.80% 4.40% 1.79% 0.00% NA
Japonica Intermediate  241 97.50% 1.70% 0.83% 0.00% NA
VI/Aromatic  96 87.50% 11.50% 1.04% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0301209725 C -> T LOC_Os03g02970.1 upstream_gene_variant ; 4886.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301209725 C -> T LOC_Os03g02980.2 upstream_gene_variant ; 1954.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301209725 C -> T LOC_Os03g02980.1 upstream_gene_variant ; 1956.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0301209725 C -> T LOC_Os03g02970-LOC_Os03g02980 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0301209725 C T -0.05 -0.03 -0.02 -0.04 -0.04 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0301209725 NA 6.41E-09 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301209725 3.71E-06 1.89E-06 mr1387 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301209725 NA 3.05E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0301209725 NA 2.59E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251