\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0300892445:

Variant ID: vg0300892445 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 892445
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


AAATAATTTACTACAAAGTATGTTTTCCAATATTAATTAAGAAAATACTTGAAAATAGCAGGGCATGTCGCCCTCATGTATTAGGGTGAGGACAGGGATA[G/T]
ATGATACATAACTACGTACATATACCTAACGTAACGTAATGGATGGTAACAGTGGGGTGTGGGCCTTTCTTTTTTTTTCTTTAAGTAAATCCGATGGTAG

Reverse complement sequence

CTACCATCGGATTTACTTAAAGAAAAAAAAAGAAAGGCCCACACCCCACTGTTACCATCCATTACGTTACGTTAGGTATATGTACGTAGTTATGTATCAT[C/A]
TATCCCTGTCCTCACCCTAATACATGAGGGCGACATGCCCTGCTATTTTCAAGTATTTTCTTAATTAATATTGGAAAACATACTTTGTAGTAAATTATTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.60% 11.40% 0.76% 48.26% NA
All Indica  2759 22.00% 0.90% 0.76% 76.33% NA
All Japonica  1512 66.30% 32.50% 0.66% 0.53% NA
Aus  269 53.90% 0.00% 0.74% 45.35% NA
Indica I  595 11.30% 0.50% 0.67% 87.56% NA
Indica II  465 61.50% 4.10% 1.08% 33.33% NA
Indica III  913 4.30% 0.00% 0.33% 95.40% NA
Indica Intermediate  786 27.20% 0.50% 1.15% 71.12% NA
Temperate Japonica  767 42.40% 56.20% 1.04% 0.39% NA
Tropical Japonica  504 93.50% 5.80% 0.20% 0.60% NA
Japonica Intermediate  241 85.90% 12.90% 0.41% 0.83% NA
VI/Aromatic  96 80.20% 5.20% 1.04% 13.54% NA
Intermediate  90 44.40% 17.80% 2.22% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0300892445 G -> T LOC_Os03g02470.1 upstream_gene_variant ; 2927.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0300892445 G -> T LOC_Os03g02470.3 upstream_gene_variant ; 3777.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0300892445 G -> T LOC_Os03g02470.2 upstream_gene_variant ; 2927.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0300892445 G -> T LOC_Os03g02470-LOC_Os03g02480 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0300892445 G -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0300892445 NA 5.58E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445 NA 2.63E-07 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445 NA 5.57E-22 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445 NA 2.09E-12 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445 NA 4.65E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445 NA 5.94E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445 NA 6.17E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445 NA 1.32E-07 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445 NA 9.13E-07 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445 NA 3.12E-07 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445 NA 2.52E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445 NA 1.32E-08 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445 3.54E-06 NA mr1341_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445 NA 1.06E-07 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445 NA 9.08E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445 NA 3.70E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445 NA 8.37E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445 NA 6.26E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445 NA 3.19E-09 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445 NA 4.59E-07 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445 NA 5.02E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445 NA 5.16E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445 NA 3.54E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445 NA 6.03E-09 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445 NA 5.52E-07 mr1977_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251