Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0300892445:

Variant ID: vg0300892445 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 892445
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

AAATAATTTACTACAAAGTATGTTTTCCAATATTAATTAAGAAAATACTTGAAAATAGCAGGGCATGTCGCCCTCATGTATTAGGGTGAGGACAGGGATA[G/T]
ATGATACATAACTACGTACATATACCTAACGTAACGTAATGGATGGTAACAGTGGGGTGTGGGCCTTTCTTTTTTTTTCTTTAAGTAAATCCGATGGTAG

Reverse complement sequence

CTACCATCGGATTTACTTAAAGAAAAAAAAAGAAAGGCCCACACCCCACTGTTACCATCCATTACGTTACGTTAGGTATATGTACGTAGTTATGTATCAT[C/A]
TATCCCTGTCCTCACCCTAATACATGAGGGCGACATGCCCTGCTATTTTCAAGTATTTTCTTAATTAATATTGGAAAACATACTTTGTAGTAAATTATTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.60%	11.40%	0.76%	48.26%	NA
All Indica	2759	22.00%	0.90%	0.76%	76.33%	NA
All Japonica	1512	66.30%	32.50%	0.66%	0.53%	NA
Aus	269	53.90%	0.00%	0.74%	45.35%	NA
Indica I	595	11.30%	0.50%	0.67%	87.56%	NA
Indica II	465	61.50%	4.10%	1.08%	33.33%	NA
Indica III	913	4.30%	0.00%	0.33%	95.40%	NA
Indica Intermediate	786	27.20%	0.50%	1.15%	71.12%	NA
Temperate Japonica	767	42.40%	56.20%	1.04%	0.39%	NA
Tropical Japonica	504	93.50%	5.80%	0.20%	0.60%	NA
Japonica Intermediate	241	85.90%	12.90%	0.41%	0.83%	NA
VI/Aromatic	96	80.20%	5.20%	1.04%	13.54%	NA
Intermediate	90	44.40%	17.80%	2.22%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0300892445	G -> T	LOC_Os03g02470.1	upstream_gene_variant ; 2927.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0300892445	G -> T	LOC_Os03g02470.3	upstream_gene_variant ; 3777.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0300892445	G -> T	LOC_Os03g02470.2	upstream_gene_variant ; 2927.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0300892445	G -> T	LOC_Os03g02470-LOC_Os03g02480	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0300892445	G -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0300892445	NA	5.58E-07	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445	NA	2.63E-07	mr1606	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445	NA	5.57E-22	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445	NA	2.09E-12	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445	NA	4.65E-07	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445	NA	5.94E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445	NA	6.17E-08	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445	NA	1.32E-07	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445	NA	9.13E-07	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445	NA	3.12E-07	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445	NA	2.52E-06	mr1332_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445	NA	1.32E-08	mr1338_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445	3.54E-06	NA	mr1341_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445	NA	1.06E-07	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445	NA	9.08E-06	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445	NA	3.70E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445	NA	8.37E-06	mr1596_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445	NA	6.26E-09	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445	NA	3.19E-09	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445	NA	4.59E-07	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445	NA	5.02E-07	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445	NA	5.16E-06	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445	NA	3.54E-07	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445	NA	6.03E-09	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300892445	NA	5.52E-07	mr1977_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251