Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0300707950:

Variant ID: vg0300707950 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 707950
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 340. )

Flanking Sequence (100 bp) in Reference Genome:

TTGACCATTTGCAGGTCAGAATCGAAACTGATCCACAAGATAGAACGCAACTCCGGCTCACAGTGGCATCAGGAGATCAGTATTTGACATTCGAGTAAAT[A/C]
TCGTTCCATTATATTTATTGTATCTTGTGGTTAATGGCTATTAGGAAAACCAAAGTTGATCTCGGGATTTTACCAAACAGGTTGAAAGAGTACATCAAGG

Reverse complement sequence

CCTTGATGTACTCTTTCAACCTGTTTGGTAAAATCCCGAGATCAACTTTGGTTTTCCTAATAGCCATTAACCACAAGATACAATAAATATAATGGAACGA[T/G]
ATTTACTCGAATGTCAAATACTGATCTCCTGATGCCACTGTGAGCCGGAGTTGCGTTCTATCTTGTGGATCAGTTTCGATTCTGACCTGCAAATGGTCAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.50%	10.30%	0.17%	0.00%	NA
All Indica	2759	99.20%	0.80%	0.00%	0.00%	NA
All Japonica	1512	69.60%	29.90%	0.46%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	96.10%	3.90%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	47.70%	51.40%	0.91%	0.00%	NA
Tropical Japonica	504	94.20%	5.80%	0.00%	0.00%	NA
Japonica Intermediate	241	88.00%	12.00%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	87.80%	11.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0300707950	A -> C	LOC_Os03g02150.1	splice_region_variant ; LOW	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0300707950	A -> C	LOC_Os03g02150.2	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0300707950	A -> C	LOC_Os03g02150.1	3_prime_UTR_variant ; 3.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0300707950	NA	1.25E-08	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300707950	NA	8.03E-06	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300707950	NA	2.51E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300707950	NA	1.02E-08	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300707950	NA	1.06E-06	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300707950	NA	4.88E-07	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300707950	NA	6.12E-08	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300707950	NA	4.35E-07	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300707950	NA	1.00E-07	mr1338_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300707950	NA	5.47E-06	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300707950	NA	5.93E-06	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300707950	NA	6.39E-06	mr1428_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300707950	NA	2.45E-06	mr1596_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300707950	NA	9.04E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300707950	NA	4.08E-10	mr1627_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300707950	NA	8.25E-06	mr1747_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300707950	NA	5.16E-08	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300707950	NA	8.96E-08	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300707950	NA	4.18E-06	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300707950	NA	4.44E-09	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300707950	NA	6.78E-07	mr1977_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251