Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0300546862:

Variant ID: vg0300546862 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 546862
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

TTAAGTAATTATTAATTCTTTTCCTATCATTTGATTCATTGTTAAATATGCTTTTATATATACATATAGTTTTACATATTTCACAAAAGTTTTTGAAAAA[G/A]
ACGAATGGTCAAACATGTCTAGAAAAGTCAATGGCGTCAAACATTTAGAGAAGGAGGGTCTCTGTTTTTCTTTTTTCCCTTTCACCTTTGCAATTTACTA

Reverse complement sequence

TAGTAAATTGCAAAGGTGAAAGGGAAAAAAGAAAAACAGAGACCCTCCTTCTCTAAATGTTTGACGCCATTGACTTTTCTAGACATGTTTGACCATTCGT[C/T]
TTTTTCAAAAACTTTTGTGAAATATGTAAAACTATATGTATATATAAAAGCATATTTAACAATGAATCAAATGATAGGAAAAGAATTAATAATTACTTAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.10%	45.60%	0.15%	0.13%	NA
All Indica	2759	85.60%	14.00%	0.18%	0.14%	NA
All Japonica	1512	0.70%	99.30%	0.00%	0.00%	NA
Aus	269	53.50%	46.50%	0.00%	0.00%	NA
Indica I	595	97.60%	2.00%	0.34%	0.00%	NA
Indica II	465	61.90%	38.10%	0.00%	0.00%	NA
Indica III	913	96.40%	3.40%	0.11%	0.11%	NA
Indica Intermediate	786	78.10%	21.20%	0.25%	0.38%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	0.80%	99.20%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	9.40%	88.50%	1.04%	1.04%	NA
Intermediate	90	36.70%	61.10%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0300546862	G -> A	LOC_Os03g01890.1	upstream_gene_variant ; 2961.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0300546862	G -> A	LOC_Os03g01890.2	upstream_gene_variant ; 2961.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0300546862	G -> A	LOC_Os03g01880.1	downstream_gene_variant ; 4091.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0300546862	G -> A	LOC_Os03g01880.2	downstream_gene_variant ; 4091.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0300546862	G -> A	LOC_Os03g01880-LOC_Os03g01890	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0300546862	G -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0300546862	7.32E-06	NA	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300546862	2.96E-06	NA	mr1116	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300546862	NA	7.12E-13	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251