\
| Variant ID: vg0300546862 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 546862 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 109. )
TTAAGTAATTATTAATTCTTTTCCTATCATTTGATTCATTGTTAAATATGCTTTTATATATACATATAGTTTTACATATTTCACAAAAGTTTTTGAAAAA[G/A]
ACGAATGGTCAAACATGTCTAGAAAAGTCAATGGCGTCAAACATTTAGAGAAGGAGGGTCTCTGTTTTTCTTTTTTCCCTTTCACCTTTGCAATTTACTA
TAGTAAATTGCAAAGGTGAAAGGGAAAAAAGAAAAACAGAGACCCTCCTTCTCTAAATGTTTGACGCCATTGACTTTTCTAGACATGTTTGACCATTCGT[C/T]
TTTTTCAAAAACTTTTGTGAAATATGTAAAACTATATGTATATATAAAAGCATATTTAACAATGAATCAAATGATAGGAAAAGAATTAATAATTACTTAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.10% | 45.60% | 0.15% | 0.13% | NA |
| All Indica | 2759 | 85.60% | 14.00% | 0.18% | 0.14% | NA |
| All Japonica | 1512 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 53.50% | 46.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.60% | 2.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 61.90% | 38.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.40% | 3.40% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 78.10% | 21.20% | 0.25% | 0.38% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 9.40% | 88.50% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 36.70% | 61.10% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0300546862 | G -> A | LOC_Os03g01890.1 | upstream_gene_variant ; 2961.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0300546862 | G -> A | LOC_Os03g01890.2 | upstream_gene_variant ; 2961.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0300546862 | G -> A | LOC_Os03g01880.1 | downstream_gene_variant ; 4091.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0300546862 | G -> A | LOC_Os03g01880.2 | downstream_gene_variant ; 4091.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0300546862 | G -> A | LOC_Os03g01880-LOC_Os03g01890 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0300546862 | G -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0300546862 | 7.32E-06 | NA | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300546862 | 2.96E-06 | NA | mr1116 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300546862 | NA | 7.12E-13 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |