| Variant ID: vg0300464166 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 464166 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, A: 0.05, others allele: 0.00, population size: 112. )
AAACGAATCTAGACATGCATATGTTCAGATTTGTTGTACTAGAATGTGCCACACCAGTTCTACATTCGTTTTTTTGGAACAAAAGGAGTAAATTACAATC[C/A]
ATACTATGTATTCTAAAAAATTCTTACAAATTTTCATATAATGTTGTCCTTTAACCATTTTCATTTACACAATAGCTAACTTTACATTTTAATTTGGACC
GGTCCAAATTAAAATGTAAAGTTAGCTATTGTGTAAATGAAAATGGTTAAAGGACAACATTATATGAAAATTTGTAAGAATTTTTTAGAATACATAGTAT[G/T]
GATTGTAATTTACTCCTTTTGTTCCAAAAAAACGAATGTAGAACTGGTGTGGCACATTCTAGTACAACAAATCTGAACATATGCATGTCTAGATTCGTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.60% | 48.20% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 82.30% | 17.40% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 0.20% | 99.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 50.90% | 49.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 2.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 60.60% | 38.90% | 0.43% | 0.00% | NA |
| Indica III | 913 | 88.00% | 11.80% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 77.10% | 22.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.20% | 99.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 27.80% | 71.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0300464166 | C -> A | LOC_Os03g01730.1 | upstream_gene_variant ; 1012.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0300464166 | C -> A | LOC_Os03g01730.2 | upstream_gene_variant ; 1012.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0300464166 | C -> A | LOC_Os03g01730.3 | upstream_gene_variant ; 1012.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0300464166 | C -> A | LOC_Os03g01730.4 | upstream_gene_variant ; 1012.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0300464166 | C -> A | LOC_Os03g01730.6 | upstream_gene_variant ; 1012.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0300464166 | C -> A | LOC_Os03g01730.5 | upstream_gene_variant ; 1857.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0300464166 | C -> A | LOC_Os03g01720.1 | downstream_gene_variant ; 4861.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0300464166 | C -> A | LOC_Os03g01720-LOC_Os03g01730 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0300464166 | NA | 9.67E-06 | mr1450 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300464166 | NA | 5.69E-08 | mr1607 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300464166 | NA | 7.44E-07 | mr1818 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300464166 | NA | 1.16E-08 | mr1050_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300464166 | NA | 6.42E-06 | mr1188_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300464166 | NA | 1.20E-06 | mr1317_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300464166 | NA | 9.29E-08 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300464166 | NA | 4.27E-06 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300464166 | NA | 2.15E-07 | mr1428_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300464166 | NA | 2.02E-32 | mr1598_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300464166 | NA | 2.98E-06 | mr1732_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300464166 | NA | 3.04E-07 | mr1875_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300464166 | NA | 7.70E-06 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300464166 | NA | 2.37E-06 | mr1914_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |