\
| Variant ID: vg0300244541 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 244541 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTGAAAAGAAAAGAAAGAGGGAGGAGGGGTAGACTTTCCTCGGGCGGCTAGGGCGCGGCCCGAGAGGAGAGGCGCGGCTCGGCCGAGCTAATGGGCCGGC[T/C]
GACCCGAGAAGGCAGCCCAAGGGCACGCGCGGGGAGAGAGGGAGGGGGAACCGGTGGGCCGGGTCCACCTCACGTGGTCCCGAGTGGGACCCGCTTGTTG
CAACAAGCGGGTCCCACTCGGGACCACGTGAGGTGGACCCGGCCCACCGGTTCCCCCTCCCTCTCTCCCCGCGCGTGCCCTTGGGCTGCCTTCTCGGGTC[A/G]
GCCGGCCCATTAGCTCGGCCGAGCCGCGCCTCTCCTCTCGGGCCGCGCCCTAGCCGCCCGAGGAAAGTCTACCCCTCCTCCCTCTTTCTTTTCTTTTCAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.60% | 18.80% | 0.66% | 0.00% | NA |
| All Indica | 2759 | 97.50% | 2.30% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 45.60% | 52.70% | 1.65% | 0.00% | NA |
| Aus | 269 | 97.80% | 1.90% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 91.60% | 8.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.30% | 2.30% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 13.80% | 84.60% | 1.56% | 0.00% | NA |
| Tropical Japonica | 504 | 87.30% | 11.70% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 59.80% | 36.90% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 24.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0300244541 | T -> C | LOC_Os03g01330-LOC_Os03g01340 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0300244541 | NA | 2.47E-11 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0300244541 | NA | 6.50E-30 | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300244541 | NA | 8.69E-11 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300244541 | NA | 1.04E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300244541 | NA | 2.79E-10 | mr1183 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300244541 | NA | 4.05E-09 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300244541 | NA | 3.68E-07 | mr1530 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300244541 | NA | 7.99E-06 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300244541 | 9.16E-06 | 7.14E-27 | mr1617 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300244541 | NA | 2.55E-09 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300244541 | NA | 8.35E-06 | mr1794 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300244541 | NA | 8.98E-09 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300244541 | NA | 1.30E-06 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300244541 | NA | 1.84E-10 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300244541 | NA | 2.93E-10 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0300244541 | NA | 8.86E-08 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |