\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0300180852:

Variant ID: vg0300180852 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 180852
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTTATTCAAATATCTTATACTCTTGTTGTTTGTAACACAGATATTTAAGAAATTATTCATAGAAAAAAAATAAAATTCGACACTTCAAAACGATAAAA[C/T]
GAAAAGTATTATTCATACTGCCCGGAATTTCGCCTACTATACCTAGCTAATCAACCATAAGCACTACATAATTATCAGATATTGAGATCTACTCTAATCC

Reverse complement sequence

GGATTAGAGTAGATCTCAATATCTGATAATTATGTAGTGCTTATGGTTGATTAGCTAGGTATAGTAGGCGAAATTCCGGGCAGTATGAATAATACTTTTC[G/A]
TTTTATCGTTTTGAAGTGTCGAATTTTATTTTTTTTCTATGAATAATTTCTTAAATATCTGTGTTACAAACAACAAGAGTATAAGATATTTGAATAAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.80% 44.00% 1.18% 0.00% NA
All Indica  2759 32.50% 66.70% 0.80% 0.00% NA
All Japonica  1512 90.20% 7.90% 1.92% 0.00% NA
Aus  269 69.50% 30.10% 0.37% 0.00% NA
Indica I  595 20.30% 78.80% 0.84% 0.00% NA
Indica II  465 37.60% 60.40% 1.94% 0.00% NA
Indica III  913 36.80% 63.00% 0.22% 0.00% NA
Indica Intermediate  786 33.60% 65.60% 0.76% 0.00% NA
Temperate Japonica  767 95.80% 2.20% 1.96% 0.00% NA
Tropical Japonica  504 79.60% 18.50% 1.98% 0.00% NA
Japonica Intermediate  241 94.60% 3.70% 1.66% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 65.60% 30.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0300180852 C -> T LOC_Os03g01260.1 upstream_gene_variant ; 646.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0300180852 C -> T LOC_Os03g01260-LOC_Os03g01270 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0300180852 C T 0.03 0.01 0.01 0.0 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0300180852 2.23E-07 6.82E-08 mr1069 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300180852 4.41E-07 4.71E-07 mr1075 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300180852 3.53E-06 6.95E-07 mr1124 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300180852 1.48E-07 1.48E-07 mr1200 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300180852 NA 7.39E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300180852 1.40E-08 1.40E-08 mr1861 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300180852 NA 1.35E-08 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300180852 NA 5.03E-06 mr1364_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300180852 NA 2.36E-09 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300180852 NA 3.84E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0300180852 NA 1.76E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251