Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235919875:

Variant ID: vg0235919875 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 35919875
Reference Allele: GGGA	Alternative Allele: AGGA,G
Primary Allele: GGGA	Secondary Allele: AGGA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGGTCAGGTACACTCCACGTTGAAGATCATCATGCAACATGTTGGTGTTGGTTGGATGAACGGCGAAGACGAGCTTGACGACCACAGCATAGCGAAGAT[GGGA/AGGA,G]
GGAGAACCAGGTCCCACTGGGCGTGCCAATTTGTTTAGGGTGGAAAATAACATCTGAGATCTCGTTTGTTTAGAGATACATATATGTGCGGGCGTGCCAG

Reverse complement sequence

CTGGCACGCCCGCACATATATGTATCTCTAAACAAACGAGATCTCAGATGTTATTTTCCACCCTAAACAAATTGGCACGCCCAGTGGGACCTGGTTCTCC[TCCC/TCCT,C]
ATCTTCGCTATGCTGTGGTCGTCAAGCTCGTCTTCGCCGTTCATCCAACCAACACCAACATGTTGCATGATGATCTTCAACGTGGAGTGTACCTGACCAA

Allele Frequencies:

Populations	Population Size	Frequency of GGGA(primary allele)	Frequency of AGGA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.40%	0.60%	0.49%	0.49%	NA
All Indica	2759	98.00%	1.00%	0.76%	0.25%	NA
All Japonica	1512	98.90%	0.00%	0.13%	0.99%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	95.00%	2.90%	2.18%	0.00%	NA
Indica II	465	99.40%	0.40%	0.00%	0.22%	NA
Indica III	913	99.20%	0.00%	0.55%	0.22%	NA
Indica Intermediate	786	98.00%	1.10%	0.38%	0.51%	NA
Temperate Japonica	767	97.80%	0.00%	0.26%	1.96%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	0.00%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0235919875	GGGA -> G	LOC_Os02g58790.1	upstream_gene_variant ; 4030.0bp to feature; MODIFIER	N	Average:19.014; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0235919875	GGGA -> G	LOC_Os02g58790.2	upstream_gene_variant ; 4030.0bp to feature; MODIFIER	N	Average:19.014; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0235919875	GGGA -> G	LOC_Os02g58790.3	upstream_gene_variant ; 4030.0bp to feature; MODIFIER	N	Average:19.014; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0235919875	GGGA -> G	LOC_Os02g58790.4	upstream_gene_variant ; 4030.0bp to feature; MODIFIER	N	Average:19.014; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0235919875	GGGA -> G	LOC_Os02g58790.5	upstream_gene_variant ; 4030.0bp to feature; MODIFIER	N	Average:19.014; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0235919875	GGGA -> G	LOC_Os02g58780.1	intron_variant ; MODIFIER	N	Average:19.014; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0235919875	GGGA -> DEL	N	N	silent_mutation	Average:19.014; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0235919875	GGGA -> AGGA	LOC_Os02g58790.1	upstream_gene_variant ; 4031.0bp to feature; MODIFIER	silent_mutation	Average:19.014; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0235919875	GGGA -> AGGA	LOC_Os02g58790.2	upstream_gene_variant ; 4031.0bp to feature; MODIFIER	silent_mutation	Average:19.014; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0235919875	GGGA -> AGGA	LOC_Os02g58790.3	upstream_gene_variant ; 4031.0bp to feature; MODIFIER	silent_mutation	Average:19.014; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0235919875	GGGA -> AGGA	LOC_Os02g58790.4	upstream_gene_variant ; 4031.0bp to feature; MODIFIER	silent_mutation	Average:19.014; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0235919875	GGGA -> AGGA	LOC_Os02g58790.5	upstream_gene_variant ; 4031.0bp to feature; MODIFIER	silent_mutation	Average:19.014; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0235919875	GGGA -> AGGA	LOC_Os02g58780.1	intron_variant ; MODIFIER	silent_mutation	Average:19.014; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0235919875	3.13E-06	2.10E-07	mr1128	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235919875	NA	9.55E-07	mr1053_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235919875	NA	2.82E-07	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235919875	NA	8.72E-06	mr1454_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251