\
| Variant ID: vg0235815991 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 35815991 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 322. )
CAGCGTGGCAATTACAATGCAGCATGATTCCATGCATAACTTTCACAGGTGATATCGACTGAGTGGGTTTTGGCACCAACTTAGGAGTTAGAAAAAACAA[T/G]
AACAGACCAAAAAAAATCTGGATTCTGAAAATAAAGGAATGAAGGCACAAAGCATACTTCAGGATAGATTCAACTGTCCTTTGCAAATAGTCTGGTCGAT
ATCGACCAGACTATTTGCAAAGGACAGTTGAATCTATCCTGAAGTATGCTTTGTGCCTTCATTCCTTTATTTTCAGAATCCAGATTTTTTTTGGTCTGTT[A/C]
TTGTTTTTTCTAACTCCTAAGTTGGTGCCAAAACCCACTCAGTCGATATCACCTGTGAAAGTTATGCATGGAATCATGCTGCATTGTAATTGCCACGCTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.50% | 1.80% | 0.66% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 92.50% | 5.60% | 1.92% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 85.30% | 11.00% | 3.78% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0235815991 | T -> G | LOC_Os02g58600.1 | upstream_gene_variant ; 3117.0bp to feature; MODIFIER | silent_mutation | Average:49.323; most accessible tissue: Callus, score: 74.217 | N | N | N | N |
| vg0235815991 | T -> G | LOC_Os02g58580.1 | downstream_gene_variant ; 3545.0bp to feature; MODIFIER | silent_mutation | Average:49.323; most accessible tissue: Callus, score: 74.217 | N | N | N | N |
| vg0235815991 | T -> G | LOC_Os02g58580.2 | downstream_gene_variant ; 3545.0bp to feature; MODIFIER | silent_mutation | Average:49.323; most accessible tissue: Callus, score: 74.217 | N | N | N | N |
| vg0235815991 | T -> G | LOC_Os02g58580.4 | downstream_gene_variant ; 3545.0bp to feature; MODIFIER | silent_mutation | Average:49.323; most accessible tissue: Callus, score: 74.217 | N | N | N | N |
| vg0235815991 | T -> G | LOC_Os02g58580.5 | downstream_gene_variant ; 3545.0bp to feature; MODIFIER | silent_mutation | Average:49.323; most accessible tissue: Callus, score: 74.217 | N | N | N | N |
| vg0235815991 | T -> G | LOC_Os02g58590.1 | intron_variant ; MODIFIER | silent_mutation | Average:49.323; most accessible tissue: Callus, score: 74.217 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0235815991 | NA | 9.98E-08 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235815991 | 9.63E-06 | 6.69E-08 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235815991 | 4.73E-06 | 4.73E-06 | mr1409 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235815991 | NA | 1.91E-09 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235815991 | NA | 1.51E-07 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235815991 | NA | 8.46E-07 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235815991 | 2.76E-08 | 1.98E-10 | mr1305_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235815991 | 3.25E-06 | 3.75E-09 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |