\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235782900:

Variant ID: vg0235782900 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 35782900
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.10, T: 0.01, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


CTAGCATTTCTCACATTGTTAATGAATCTAGACATATATATCTATCTAGATTTATTAACATCAATACGAATGTAGGAAATGTTAGAATGACTTACATTAT[A/G]
AAATGGAGGAAGTATTATATTATTTCAGTGGACTAAAACACTACGACAAAATTAAGAAGTAAGCAGTGTTCTTGTCACACCTTCTTCGAACACGCAAGAA

Reverse complement sequence

TTCTTGCGTGTTCGAAGAAGGTGTGACAAGAACACTGCTTACTTCTTAATTTTGTCGTAGTGTTTTAGTCCACTGAAATAATATAATACTTCCTCCATTT[T/C]
ATAATGTAAGTCATTCTAACATTTCCTACATTCGTATTGATGTTAATAAATCTAGATAGATATATATGTCTAGATTCATTAACAATGTGAGAAATGCTAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.70% 27.10% 0.19% 0.00% NA
All Indica  2759 58.00% 41.80% 0.25% 0.00% NA
All Japonica  1512 96.70% 3.30% 0.00% 0.00% NA
Aus  269 78.10% 21.60% 0.37% 0.00% NA
Indica I  595 23.20% 76.50% 0.34% 0.00% NA
Indica II  465 56.80% 42.80% 0.43% 0.00% NA
Indica III  913 78.60% 21.20% 0.11% 0.00% NA
Indica Intermediate  786 60.90% 38.80% 0.25% 0.00% NA
Temperate Japonica  767 95.00% 5.00% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 83.30% 15.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0235782900 A -> G LOC_Os02g58530.1 downstream_gene_variant ; 1512.0bp to feature; MODIFIER silent_mutation Average:56.056; most accessible tissue: Minghui63 root, score: 78.091 N N N N
vg0235782900 A -> G LOC_Os02g58540.1 downstream_gene_variant ; 384.0bp to feature; MODIFIER silent_mutation Average:56.056; most accessible tissue: Minghui63 root, score: 78.091 N N N N
vg0235782900 A -> G LOC_Os02g58550.1 downstream_gene_variant ; 1942.0bp to feature; MODIFIER silent_mutation Average:56.056; most accessible tissue: Minghui63 root, score: 78.091 N N N N
vg0235782900 A -> G LOC_Os02g58550.2 downstream_gene_variant ; 2968.0bp to feature; MODIFIER silent_mutation Average:56.056; most accessible tissue: Minghui63 root, score: 78.091 N N N N
vg0235782900 A -> G LOC_Os02g58530-LOC_Os02g58540 intergenic_region ; MODIFIER silent_mutation Average:56.056; most accessible tissue: Minghui63 root, score: 78.091 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0235782900 NA 2.60E-10 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0235782900 NA 2.11E-09 mr1125_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235782900 NA 7.06E-07 mr1924_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251