\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235593093:

Variant ID: vg0235593093 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 35593093
Reference Allele: GAlternative Allele: A,GA
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAATATCATATTCGTTTTCATTCCGAAAAATAATAATATCCGAACTCATTTCCGAATTCGAAAATTTCCGAATATATCCGACCGAAACTATCCGAATCC[G/A,GA]
AAAAAAGTCTGGTTGGATGGAAACTATTCGAATCACTTTCAACCCTACGCCACTACGCCAGACACCTGCTAGCTAACTGCAGTTCATTATCCGGTCTGAC

Reverse complement sequence

GTCAGACCGGATAATGAACTGCAGTTAGCTAGCAGGTGTCTGGCGTAGTGGCGTAGGGTTGAAAGTGATTCGAATAGTTTCCATCCAACCAGACTTTTTT[C/T,TC]
GGATTCGGATAGTTTCGGTCGGATATATTCGGAAATTTTCGAATTCGGAAATGAGTTCGGATATTATTATTTTTCGGAATGAAAACGAATATGATATTGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.30% 39.40% 0.21% 0.00% GA: 0.02%
All Indica  2759 95.60% 4.20% 0.18% 0.00% NA
All Japonica  1512 4.30% 95.70% 0.00% 0.00% NA
Aus  269 34.60% 64.70% 0.74% 0.00% NA
Indica I  595 97.30% 2.70% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 97.40% 2.50% 0.11% 0.00% NA
Indica Intermediate  786 91.00% 8.50% 0.51% 0.00% NA
Temperate Japonica  767 5.90% 94.10% 0.00% 0.00% NA
Tropical Japonica  504 2.40% 97.60% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 20.80% 78.10% 0.00% 0.00% GA: 1.04%
Intermediate  90 40.00% 56.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0235593093 G -> A LOC_Os02g58170.1 upstream_gene_variant ; 2520.0bp to feature; MODIFIER silent_mutation Average:50.763; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg0235593093 G -> A LOC_Os02g58150.1 downstream_gene_variant ; 3844.0bp to feature; MODIFIER silent_mutation Average:50.763; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg0235593093 G -> A LOC_Os02g58150-LOC_Os02g58170 intergenic_region ; MODIFIER silent_mutation Average:50.763; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg0235593093 G -> GA LOC_Os02g58170.1 upstream_gene_variant ; 2519.0bp to feature; MODIFIER silent_mutation Average:50.763; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg0235593093 G -> GA LOC_Os02g58150.1 downstream_gene_variant ; 3845.0bp to feature; MODIFIER silent_mutation Average:50.763; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg0235593093 G -> GA LOC_Os02g58150-LOC_Os02g58170 intergenic_region ; MODIFIER silent_mutation Average:50.763; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0235593093 4.38E-06 NA mr1216_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235593093 4.03E-06 4.03E-06 mr1259_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235593093 NA 7.91E-23 mr1386_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235593093 NA 1.00E-12 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235593093 5.57E-06 5.57E-06 mr1710_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235593093 9.17E-07 9.17E-07 mr1852_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251