\
| Variant ID: vg0235593093 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr02 | Position: 35593093 |
| Reference Allele: G | Alternative Allele: A,GA |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CCAATATCATATTCGTTTTCATTCCGAAAAATAATAATATCCGAACTCATTTCCGAATTCGAAAATTTCCGAATATATCCGACCGAAACTATCCGAATCC[G/A,GA]
AAAAAAGTCTGGTTGGATGGAAACTATTCGAATCACTTTCAACCCTACGCCACTACGCCAGACACCTGCTAGCTAACTGCAGTTCATTATCCGGTCTGAC
GTCAGACCGGATAATGAACTGCAGTTAGCTAGCAGGTGTCTGGCGTAGTGGCGTAGGGTTGAAAGTGATTCGAATAGTTTCCATCCAACCAGACTTTTTT[C/T,TC]
GGATTCGGATAGTTTCGGTCGGATATATTCGGAAATTTTCGAATTCGGAAATGAGTTCGGATATTATTATTTTTCGGAATGAAAACGAATATGATATTGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.30% | 39.40% | 0.21% | 0.00% | GA: 0.02% |
| All Indica | 2759 | 95.60% | 4.20% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 4.30% | 95.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 34.60% | 64.70% | 0.74% | 0.00% | NA |
| Indica I | 595 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.40% | 2.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 91.00% | 8.50% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 5.90% | 94.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.40% | 97.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 20.80% | 78.10% | 0.00% | 0.00% | GA: 1.04% |
| Intermediate | 90 | 40.00% | 56.70% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0235593093 | G -> A | LOC_Os02g58170.1 | upstream_gene_variant ; 2520.0bp to feature; MODIFIER | silent_mutation | Average:50.763; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| vg0235593093 | G -> A | LOC_Os02g58150.1 | downstream_gene_variant ; 3844.0bp to feature; MODIFIER | silent_mutation | Average:50.763; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| vg0235593093 | G -> A | LOC_Os02g58150-LOC_Os02g58170 | intergenic_region ; MODIFIER | silent_mutation | Average:50.763; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| vg0235593093 | G -> GA | LOC_Os02g58170.1 | upstream_gene_variant ; 2519.0bp to feature; MODIFIER | silent_mutation | Average:50.763; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| vg0235593093 | G -> GA | LOC_Os02g58150.1 | downstream_gene_variant ; 3845.0bp to feature; MODIFIER | silent_mutation | Average:50.763; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| vg0235593093 | G -> GA | LOC_Os02g58150-LOC_Os02g58170 | intergenic_region ; MODIFIER | silent_mutation | Average:50.763; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0235593093 | 4.38E-06 | NA | mr1216_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235593093 | 4.03E-06 | 4.03E-06 | mr1259_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235593093 | NA | 7.91E-23 | mr1386_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235593093 | NA | 1.00E-12 | mr1521_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235593093 | 5.57E-06 | 5.57E-06 | mr1710_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235593093 | 9.17E-07 | 9.17E-07 | mr1852_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |