\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235590636:

Variant ID: vg0235590636 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 35590636
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCTGATTTTTTTTAATTTTTTAGCATGTTTTGAGTTTGAAAGTTTTTAAATTTTGAGTTGAAGATTTTCAAATCTGGATTTGAAAGTTTTCGAATCTC[G/A]
ATTTAAAATTTTCAAATCTTGATTTGAAAGTTTTCAAATCTCAAATTGAAAGTTTTTAATTTTTTTCAAATCTGGACTTGAAAGTTTTTGAATCTCTATT

Reverse complement sequence

AATAGAGATTCAAAAACTTTCAAGTCCAGATTTGAAAAAAATTAAAAACTTTCAATTTGAGATTTGAAAACTTTCAAATCAAGATTTGAAAATTTTAAAT[C/T]
GAGATTCGAAAACTTTCAAATCCAGATTTGAAAATCTTCAACTCAAAATTTAAAAACTTTCAAACTCAAAACATGCTAAAAAATTAAAAAAAATCAGAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.50% 3.20% 0.61% 56.71% NA
All Indica  2759 4.20% 4.90% 0.87% 90.03% NA
All Japonica  1512 95.60% 0.50% 0.07% 3.90% NA
Aus  269 66.20% 1.90% 0.74% 31.23% NA
Indica I  595 2.70% 4.70% 0.50% 92.10% NA
Indica II  465 2.40% 5.40% 1.29% 90.97% NA
Indica III  913 2.40% 4.90% 0.77% 91.89% NA
Indica Intermediate  786 8.50% 4.70% 1.02% 85.75% NA
Temperate Japonica  767 93.90% 0.70% 0.13% 5.35% NA
Tropical Japonica  504 97.60% 0.20% 0.00% 2.18% NA
Japonica Intermediate  241 96.70% 0.40% 0.00% 2.90% NA
VI/Aromatic  96 80.20% 1.00% 0.00% 18.75% NA
Intermediate  90 57.80% 1.10% 2.22% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0235590636 G -> A LOC_Os02g58170.1 upstream_gene_variant ; 4977.0bp to feature; MODIFIER silent_mutation Average:75.797; most accessible tissue: Zhenshan97 flag leaf, score: 92.126 N N N N
vg0235590636 G -> A LOC_Os02g58150.1 downstream_gene_variant ; 1387.0bp to feature; MODIFIER silent_mutation Average:75.797; most accessible tissue: Zhenshan97 flag leaf, score: 92.126 N N N N
vg0235590636 G -> A LOC_Os02g58150-LOC_Os02g58170 intergenic_region ; MODIFIER silent_mutation Average:75.797; most accessible tissue: Zhenshan97 flag leaf, score: 92.126 N N N N
vg0235590636 G -> DEL N N silent_mutation Average:75.797; most accessible tissue: Zhenshan97 flag leaf, score: 92.126 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0235590636 NA 7.95E-58 mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235590636 1.65E-06 NA mr1064_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235590636 NA 9.72E-38 mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251