\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).


Sorry, variation is wrong, please check.

Detailed information for vg0235583404:

Variant ID: vg0235583404 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 35583404
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGTTAGCCCCATGTGTCACTCTGTAGCAACTCATTCTGTGAGATTTTAGCTTTCTTTTTATGTCTGTAATGGTGGTGCATTGACTCATCGCGCTACCTT[G/A]
TACATTTCTTTTCTTACTCTTAATATACATTGGCCGGCTATTCTCTGGCCCGGCGAAAAAAGAAAACTCAAGTGAGAATCATGGCTTTCTGGAGAAGGCA

Reverse complement sequence

TGCCTTCTCCAGAAAGCCATGATTCTCACTTGAGTTTTCTTTTTTCGCCGGGCCAGAGAATAGCCGGCCAATGTATATTAAGAGTAAGAAAAGAAATGTA[C/T]
AAGGTAGCGCGATGAGTCAATGCACCACCATTACAGACATAAAAAGAAAGCTAAAATCTCACAGAATGAGTTGCTACAGAGTGACACATGGGGCTAACAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.70% 39.10% 0.15% 0.02% NA
All Indica  2759 96.40% 3.50% 0.14% 0.00% NA
All Japonica  1512 4.40% 95.60% 0.00% 0.00% NA
Aus  269 30.90% 68.00% 0.74% 0.37% NA
Indica I  595 96.60% 3.40% 0.00% 0.00% NA
Indica II  465 97.20% 2.20% 0.65% 0.00% NA
Indica III  913 98.00% 2.00% 0.00% 0.00% NA
Indica Intermediate  786 93.80% 6.10% 0.13% 0.00% NA
Temperate Japonica  767 6.10% 93.90% 0.00% 0.00% NA
Tropical Japonica  504 2.40% 97.60% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 19.80% 80.20% 0.00% 0.00% NA
Intermediate  90 44.40% 54.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0235583404 G -> A LOC_Os02g58160.1 upstream_gene_variant ; 580.0bp to feature; MODIFIER silent_mutation Average:66.455; most accessible tissue: Zhenshan97 root, score: 85.677 N N N N
vg0235583404 G -> A LOC_Os02g58150.1 upstream_gene_variant ; 1557.0bp to feature; MODIFIER silent_mutation Average:66.455; most accessible tissue: Zhenshan97 root, score: 85.677 N N N N
vg0235583404 G -> A LOC_Os02g58160.2 upstream_gene_variant ; 1191.0bp to feature; MODIFIER silent_mutation Average:66.455; most accessible tissue: Zhenshan97 root, score: 85.677 N N N N
vg0235583404 G -> A LOC_Os02g58160-LOC_Os02g58150 intergenic_region ; MODIFIER silent_mutation Average:66.455; most accessible tissue: Zhenshan97 root, score: 85.677 N N N N
vg0235583404 G -> DEL N N silent_mutation Average:66.455; most accessible tissue: Zhenshan97 root, score: 85.677 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0235583404 NA 1.20E-19 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235583404 NA 3.11E-11 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235583404 NA 3.93E-61 mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235583404 NA 1.25E-38 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235583404 NA 5.85E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235583404 NA 4.47E-29 mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235583404 NA 4.92E-64 mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235583404 1.97E-06 1.53E-103 mr1973_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251