\
| Variant ID: vg0235583404 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 35583404 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTGTTAGCCCCATGTGTCACTCTGTAGCAACTCATTCTGTGAGATTTTAGCTTTCTTTTTATGTCTGTAATGGTGGTGCATTGACTCATCGCGCTACCTT[G/A]
TACATTTCTTTTCTTACTCTTAATATACATTGGCCGGCTATTCTCTGGCCCGGCGAAAAAAGAAAACTCAAGTGAGAATCATGGCTTTCTGGAGAAGGCA
TGCCTTCTCCAGAAAGCCATGATTCTCACTTGAGTTTTCTTTTTTCGCCGGGCCAGAGAATAGCCGGCCAATGTATATTAAGAGTAAGAAAAGAAATGTA[C/T]
AAGGTAGCGCGATGAGTCAATGCACCACCATTACAGACATAAAAAGAAAGCTAAAATCTCACAGAATGAGTTGCTACAGAGTGACACATGGGGCTAACAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.70% | 39.10% | 0.15% | 0.02% | NA |
| All Indica | 2759 | 96.40% | 3.50% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 4.40% | 95.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 30.90% | 68.00% | 0.74% | 0.37% | NA |
| Indica I | 595 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.20% | 0.65% | 0.00% | NA |
| Indica III | 913 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.80% | 6.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 6.10% | 93.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.40% | 97.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 19.80% | 80.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 44.40% | 54.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0235583404 | G -> A | LOC_Os02g58160.1 | upstream_gene_variant ; 580.0bp to feature; MODIFIER | silent_mutation | Average:66.455; most accessible tissue: Zhenshan97 root, score: 85.677 | N | N | N | N |
| vg0235583404 | G -> A | LOC_Os02g58150.1 | upstream_gene_variant ; 1557.0bp to feature; MODIFIER | silent_mutation | Average:66.455; most accessible tissue: Zhenshan97 root, score: 85.677 | N | N | N | N |
| vg0235583404 | G -> A | LOC_Os02g58160.2 | upstream_gene_variant ; 1191.0bp to feature; MODIFIER | silent_mutation | Average:66.455; most accessible tissue: Zhenshan97 root, score: 85.677 | N | N | N | N |
| vg0235583404 | G -> A | LOC_Os02g58160-LOC_Os02g58150 | intergenic_region ; MODIFIER | silent_mutation | Average:66.455; most accessible tissue: Zhenshan97 root, score: 85.677 | N | N | N | N |
| vg0235583404 | G -> DEL | N | N | silent_mutation | Average:66.455; most accessible tissue: Zhenshan97 root, score: 85.677 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0235583404 | NA | 1.20E-19 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235583404 | NA | 3.11E-11 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235583404 | NA | 3.93E-61 | mr1064_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235583404 | NA | 1.25E-38 | mr1745_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235583404 | NA | 5.85E-11 | mr1781_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235583404 | NA | 4.47E-29 | mr1932_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235583404 | NA | 4.92E-64 | mr1970_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235583404 | 1.97E-06 | 1.53E-103 | mr1973_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |