Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235581797:

Variant ID: vg0235581797 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 35581797
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, T: 0.10, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

CGTTTGGCTTGGAATTGAAGCATCCCATCTCCTGCAAGTTTGCAGCTTGATCTGTCCGTGAATTCAGTTAGAATGAACACAACCTATAGCTGAACTACAT[G/T]
CAAGGACATGAATAATAATCAGAAGTGGTAACAAACTGAAGAAAGGTAAGACGTGTACAAACAAACAAACAAACATACATACAAGCATTTATAATAAGGT

Reverse complement sequence

ACCTTATTATAAATGCTTGTATGTATGTTTGTTTGTTTGTTTGTACACGTCTTACCTTTCTTCAGTTTGTTACCACTTCTGATTATTATTCATGTCCTTG[C/A]
ATGTAGTTCAGCTATAGGTTGTGTTCATTCTAACTGAATTCACGGACAGATCAAGCTGCAAACTTGCAGGAGATGGGATGCTTCAATTCCAAGCCAAACG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.90%	11.20%	0.91%	0.00%	NA
All Indica	2759	79.60%	19.00%	1.45%	0.00%	NA
All Japonica	1512	99.70%	0.20%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	69.20%	26.60%	4.20%	0.00%	NA
Indica II	465	97.40%	2.40%	0.22%	0.00%	NA
Indica III	913	76.50%	23.20%	0.33%	0.00%	NA
Indica Intermediate	786	80.50%	18.10%	1.40%	0.00%	NA
Temperate Japonica	767	99.70%	0.10%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	2.20%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0235581797	G -> T	LOC_Os02g58150.1	upstream_gene_variant ; 3164.0bp to feature; MODIFIER	silent_mutation	Average:63.43; most accessible tissue: Minghui63 root, score: 84.686	N	N	N	N
vg0235581797	G -> T	LOC_Os02g58139.3	upstream_gene_variant ; 3640.0bp to feature; MODIFIER	silent_mutation	Average:63.43; most accessible tissue: Minghui63 root, score: 84.686	N	N	N	N
vg0235581797	G -> T	LOC_Os02g58160.1	intron_variant ; MODIFIER	silent_mutation	Average:63.43; most accessible tissue: Minghui63 root, score: 84.686	N	N	N	N
vg0235581797	G -> T	LOC_Os02g58160.2	intron_variant ; MODIFIER	silent_mutation	Average:63.43; most accessible tissue: Minghui63 root, score: 84.686	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0235581797	NA	5.26E-06	mr1057	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797	NA	2.60E-06	mr1184_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797	6.49E-06	6.49E-06	mr1267_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797	NA	1.98E-06	mr1278_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797	6.35E-06	6.35E-06	mr1284_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797	NA	2.31E-06	mr1293_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797	NA	4.01E-07	mr1549_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797	NA	1.29E-06	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797	NA	9.51E-06	mr1669_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797	NA	4.18E-06	mr1759_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797	NA	7.65E-06	mr1759_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797	NA	6.89E-06	mr1766_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797	4.75E-06	4.74E-06	mr1812_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797	NA	8.94E-06	mr1833_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797	7.15E-06	7.15E-06	mr1833_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251