\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235581797:

Variant ID: vg0235581797 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 35581797
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, T: 0.10, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


CGTTTGGCTTGGAATTGAAGCATCCCATCTCCTGCAAGTTTGCAGCTTGATCTGTCCGTGAATTCAGTTAGAATGAACACAACCTATAGCTGAACTACAT[G/T]
CAAGGACATGAATAATAATCAGAAGTGGTAACAAACTGAAGAAAGGTAAGACGTGTACAAACAAACAAACAAACATACATACAAGCATTTATAATAAGGT

Reverse complement sequence

ACCTTATTATAAATGCTTGTATGTATGTTTGTTTGTTTGTTTGTACACGTCTTACCTTTCTTCAGTTTGTTACCACTTCTGATTATTATTCATGTCCTTG[C/A]
ATGTAGTTCAGCTATAGGTTGTGTTCATTCTAACTGAATTCACGGACAGATCAAGCTGCAAACTTGCAGGAGATGGGATGCTTCAATTCCAAGCCAAACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 11.20% 0.91% 0.00% NA
All Indica  2759 79.60% 19.00% 1.45% 0.00% NA
All Japonica  1512 99.70% 0.20% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 69.20% 26.60% 4.20% 0.00% NA
Indica II  465 97.40% 2.40% 0.22% 0.00% NA
Indica III  913 76.50% 23.20% 0.33% 0.00% NA
Indica Intermediate  786 80.50% 18.10% 1.40% 0.00% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 95.60% 2.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0235581797 G -> T LOC_Os02g58150.1 upstream_gene_variant ; 3164.0bp to feature; MODIFIER silent_mutation Average:63.43; most accessible tissue: Minghui63 root, score: 84.686 N N N N
vg0235581797 G -> T LOC_Os02g58139.3 upstream_gene_variant ; 3640.0bp to feature; MODIFIER silent_mutation Average:63.43; most accessible tissue: Minghui63 root, score: 84.686 N N N N
vg0235581797 G -> T LOC_Os02g58160.1 intron_variant ; MODIFIER silent_mutation Average:63.43; most accessible tissue: Minghui63 root, score: 84.686 N N N N
vg0235581797 G -> T LOC_Os02g58160.2 intron_variant ; MODIFIER silent_mutation Average:63.43; most accessible tissue: Minghui63 root, score: 84.686 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0235581797 NA 5.26E-06 mr1057 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797 NA 2.60E-06 mr1184_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797 6.49E-06 6.49E-06 mr1267_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797 NA 1.98E-06 mr1278_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797 6.35E-06 6.35E-06 mr1284_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797 NA 2.31E-06 mr1293_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797 NA 4.01E-07 mr1549_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797 NA 1.29E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797 NA 9.51E-06 mr1669_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797 NA 4.18E-06 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797 NA 7.65E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797 NA 6.89E-06 mr1766_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797 4.75E-06 4.74E-06 mr1812_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797 NA 8.94E-06 mr1833_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235581797 7.15E-06 7.15E-06 mr1833_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251