\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235445101:

Variant ID: vg0235445101 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 35445101
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGGCTATTTGAGTCAAGCATCTTTCTAATGTTCTTTTCTTGTCTTCCGGCCACTTTTGTTTACAACACCTCTACTCGGTGCAGGACTCCATTCTTTTT[T/G]
ACTACATCTGTCAAAGTTAAGGAAGTTAAGGGGAAAAAAAAGATGGTTACCTTGTAACAGCCACTGTTACCTCGATAGTGCCATGCTGCTCTGGCAAATC

Reverse complement sequence

GATTTGCCAGAGCAGCATGGCACTATCGAGGTAACAGTGGCTGTTACAAGGTAACCATCTTTTTTTTCCCCTTAACTTCCTTAACTTTGACAGATGTAGT[A/C]
AAAAAGAATGGAGTCCTGCACCGAGTAGAGGTGTTGTAAACAAAAGTGGCCGGAAGACAAGAAAAGAACATTAGAAAGATGCTTGACTCAAATAGCCTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.20% 9.80% 0.59% 4.40% NA
All Indica  2759 93.00% 0.30% 0.76% 5.87% NA
All Japonica  1512 72.80% 24.50% 0.40% 2.25% NA
Aus  269 97.40% 1.10% 0.00% 1.49% NA
Indica I  595 99.30% 0.30% 0.00% 0.34% NA
Indica II  465 97.20% 0.20% 0.22% 2.37% NA
Indica III  913 87.50% 0.20% 1.75% 10.51% NA
Indica Intermediate  786 92.20% 0.50% 0.51% 6.74% NA
Temperate Japonica  767 57.20% 38.50% 0.78% 3.52% NA
Tropical Japonica  504 92.90% 6.30% 0.00% 0.79% NA
Japonica Intermediate  241 80.50% 18.30% 0.00% 1.24% NA
VI/Aromatic  96 30.20% 65.60% 1.04% 3.12% NA
Intermediate  90 75.60% 18.90% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0235445101 T -> G LOC_Os02g57890.1 upstream_gene_variant ; 2493.0bp to feature; MODIFIER silent_mutation Average:62.57; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0235445101 T -> G LOC_Os02g57910.1 upstream_gene_variant ; 2494.0bp to feature; MODIFIER silent_mutation Average:62.57; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0235445101 T -> G LOC_Os02g57900.1 intron_variant ; MODIFIER silent_mutation Average:62.57; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0235445101 T -> DEL N N silent_mutation Average:62.57; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0235445101 NA 4.97E-09 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235445101 NA 2.81E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235445101 NA 8.03E-10 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235445101 NA 1.53E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235445101 7.47E-06 1.32E-13 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235445101 NA 4.11E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235445101 3.18E-08 1.06E-20 mr1842_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235445101 NA 6.45E-19 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235445101 NA 5.18E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251