| Variant ID: vg0235445101 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 35445101 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 200. )
CAAGGCTATTTGAGTCAAGCATCTTTCTAATGTTCTTTTCTTGTCTTCCGGCCACTTTTGTTTACAACACCTCTACTCGGTGCAGGACTCCATTCTTTTT[T/G]
ACTACATCTGTCAAAGTTAAGGAAGTTAAGGGGAAAAAAAAGATGGTTACCTTGTAACAGCCACTGTTACCTCGATAGTGCCATGCTGCTCTGGCAAATC
GATTTGCCAGAGCAGCATGGCACTATCGAGGTAACAGTGGCTGTTACAAGGTAACCATCTTTTTTTTCCCCTTAACTTCCTTAACTTTGACAGATGTAGT[A/C]
AAAAAGAATGGAGTCCTGCACCGAGTAGAGGTGTTGTAAACAAAAGTGGCCGGAAGACAAGAAAAGAACATTAGAAAGATGCTTGACTCAAATAGCCTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.20% | 9.80% | 0.59% | 4.40% | NA |
| All Indica | 2759 | 93.00% | 0.30% | 0.76% | 5.87% | NA |
| All Japonica | 1512 | 72.80% | 24.50% | 0.40% | 2.25% | NA |
| Aus | 269 | 97.40% | 1.10% | 0.00% | 1.49% | NA |
| Indica I | 595 | 99.30% | 0.30% | 0.00% | 0.34% | NA |
| Indica II | 465 | 97.20% | 0.20% | 0.22% | 2.37% | NA |
| Indica III | 913 | 87.50% | 0.20% | 1.75% | 10.51% | NA |
| Indica Intermediate | 786 | 92.20% | 0.50% | 0.51% | 6.74% | NA |
| Temperate Japonica | 767 | 57.20% | 38.50% | 0.78% | 3.52% | NA |
| Tropical Japonica | 504 | 92.90% | 6.30% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 80.50% | 18.30% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 30.20% | 65.60% | 1.04% | 3.12% | NA |
| Intermediate | 90 | 75.60% | 18.90% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0235445101 | T -> G | LOC_Os02g57890.1 | upstream_gene_variant ; 2493.0bp to feature; MODIFIER | silent_mutation | Average:62.57; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0235445101 | T -> G | LOC_Os02g57910.1 | upstream_gene_variant ; 2494.0bp to feature; MODIFIER | silent_mutation | Average:62.57; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0235445101 | T -> G | LOC_Os02g57900.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.57; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0235445101 | T -> DEL | N | N | silent_mutation | Average:62.57; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0235445101 | NA | 4.97E-09 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235445101 | NA | 2.81E-07 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235445101 | NA | 8.03E-10 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235445101 | NA | 1.53E-09 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235445101 | 7.47E-06 | 1.32E-13 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235445101 | NA | 4.11E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235445101 | 3.18E-08 | 1.06E-20 | mr1842_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235445101 | NA | 6.45E-19 | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235445101 | NA | 5.18E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |