Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235445101:

Variant ID: vg0235445101 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 35445101
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

CAAGGCTATTTGAGTCAAGCATCTTTCTAATGTTCTTTTCTTGTCTTCCGGCCACTTTTGTTTACAACACCTCTACTCGGTGCAGGACTCCATTCTTTTT[T/G]
ACTACATCTGTCAAAGTTAAGGAAGTTAAGGGGAAAAAAAAGATGGTTACCTTGTAACAGCCACTGTTACCTCGATAGTGCCATGCTGCTCTGGCAAATC

Reverse complement sequence

GATTTGCCAGAGCAGCATGGCACTATCGAGGTAACAGTGGCTGTTACAAGGTAACCATCTTTTTTTTCCCCTTAACTTCCTTAACTTTGACAGATGTAGT[A/C]
AAAAAGAATGGAGTCCTGCACCGAGTAGAGGTGTTGTAAACAAAAGTGGCCGGAAGACAAGAAAAGAACATTAGAAAGATGCTTGACTCAAATAGCCTTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.20%	9.80%	0.59%	4.40%	NA
All Indica	2759	93.00%	0.30%	0.76%	5.87%	NA
All Japonica	1512	72.80%	24.50%	0.40%	2.25%	NA
Aus	269	97.40%	1.10%	0.00%	1.49%	NA
Indica I	595	99.30%	0.30%	0.00%	0.34%	NA
Indica II	465	97.20%	0.20%	0.22%	2.37%	NA
Indica III	913	87.50%	0.20%	1.75%	10.51%	NA
Indica Intermediate	786	92.20%	0.50%	0.51%	6.74%	NA
Temperate Japonica	767	57.20%	38.50%	0.78%	3.52%	NA
Tropical Japonica	504	92.90%	6.30%	0.00%	0.79%	NA
Japonica Intermediate	241	80.50%	18.30%	0.00%	1.24%	NA
VI/Aromatic	96	30.20%	65.60%	1.04%	3.12%	NA
Intermediate	90	75.60%	18.90%	0.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0235445101	T -> G	LOC_Os02g57890.1	upstream_gene_variant ; 2493.0bp to feature; MODIFIER	silent_mutation	Average:62.57; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0235445101	T -> G	LOC_Os02g57910.1	upstream_gene_variant ; 2494.0bp to feature; MODIFIER	silent_mutation	Average:62.57; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0235445101	T -> G	LOC_Os02g57900.1	intron_variant ; MODIFIER	silent_mutation	Average:62.57; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N
vg0235445101	T -> DEL	N	N	silent_mutation	Average:62.57; most accessible tissue: Minghui63 panicle, score: 70.194	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0235445101	NA	4.97E-09	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235445101	NA	2.81E-07	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235445101	NA	8.03E-10	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235445101	NA	1.53E-09	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235445101	7.47E-06	1.32E-13	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235445101	NA	4.11E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235445101	3.18E-08	1.06E-20	mr1842_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235445101	NA	6.45E-19	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235445101	NA	5.18E-06	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251