Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235439519:

Variant ID: vg0235439519 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 35439519
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, C: 0.10, others allele: 0.00, population size: 145. )

Flanking Sequence (100 bp) in Reference Genome:

TGTCGAGGCGGTCCATGATGTTGAGCAGGATGTCATCAGGTAGCGTGGTGAACCTATCCACCACCATTACGGGAGCTGATTTCTGCATCGATATAGTGTT[T/C]
ATTTGTGAAACTAATAATAAATTAATTAGTGCAACAGTAGTCATGGATCGACAGGGAAAGAGAAGACTGACATGACAGATGCAATGCAAATCAGTAAGTA

Reverse complement sequence

TACTTACTGATTTGCATTGCATCTGTCATGTCAGTCTTCTCTTTCCCTGTCGATCCATGACTACTGTTGCACTAATTAATTTATTATTAGTTTCACAAAT[A/G]
AACACTATATCGATGCAGAAATCAGCTCCCGTAATGGTGGTGGATAGGTTCACCACGCTACCTGATGACATCCTGCTCAACATCATGGACCGCCTCGACA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.90%	36.00%	0.11%	0.00%	NA
All Indica	2759	97.40%	2.60%	0.07%	0.00%	NA
All Japonica	1512	4.50%	95.40%	0.13%	0.00%	NA
Aus	269	73.20%	26.80%	0.00%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	97.60%	2.40%	0.00%	0.00%	NA
Indica III	913	97.50%	2.40%	0.11%	0.00%	NA
Indica Intermediate	786	95.50%	4.30%	0.13%	0.00%	NA
Temperate Japonica	767	6.10%	93.90%	0.00%	0.00%	NA
Tropical Japonica	504	2.40%	97.40%	0.20%	0.00%	NA
Japonica Intermediate	241	3.70%	95.90%	0.41%	0.00%	NA
VI/Aromatic	96	25.00%	74.00%	1.04%	0.00%	NA
Intermediate	90	47.80%	52.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0235439519	T -> C	LOC_Os02g57870.1	upstream_gene_variant ; 3651.0bp to feature; MODIFIER	silent_mutation	Average:53.56; most accessible tissue: Callus, score: 86.581	N	N	N	N
vg0235439519	T -> C	LOC_Os02g57880.1	upstream_gene_variant ; 423.0bp to feature; MODIFIER	silent_mutation	Average:53.56; most accessible tissue: Callus, score: 86.581	N	N	N	N
vg0235439519	T -> C	LOC_Os02g57870.2	upstream_gene_variant ; 3672.0bp to feature; MODIFIER	silent_mutation	Average:53.56; most accessible tissue: Callus, score: 86.581	N	N	N	N
vg0235439519	T -> C	LOC_Os02g57890.1	downstream_gene_variant ; 1407.0bp to feature; MODIFIER	silent_mutation	Average:53.56; most accessible tissue: Callus, score: 86.581	N	N	N	N
vg0235439519	T -> C	LOC_Os02g57900.1	downstream_gene_variant ; 3821.0bp to feature; MODIFIER	silent_mutation	Average:53.56; most accessible tissue: Callus, score: 86.581	N	N	N	N
vg0235439519	T -> C	LOC_Os02g57880-LOC_Os02g57890	intergenic_region ; MODIFIER	silent_mutation	Average:53.56; most accessible tissue: Callus, score: 86.581	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0235439519	NA	2.53E-76	mr1100	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235439519	NA	6.37E-16	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235439519	NA	1.91E-22	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235439519	NA	4.89E-23	mr1571	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235439519	NA	2.07E-07	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235439519	NA	5.37E-56	mr1795	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235439519	NA	4.60E-59	mr1064_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235439519	NA	6.89E-24	mr1386_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251