\
| Variant ID: vg0235437287 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 35437287 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 277. )
TGTACTATGTGACATTATTCCTATAAATAATTAGACCTTGTGTAGTTGGCAAAAAAAAATTTACTCCTACGTGTCACATCGGATATACGGACACACATTT[G/A]
AAGTATTAAACGTTGTCTAATAACAAAACAAATTACATATTCCGTCAGGAAACTGCGAGACGAATTTATTAAACCTAATTAATCCGTCATTAGCAAAAGT
ACTTTTGCTAATGACGGATTAATTAGGTTTAATAAATTCGTCTCGCAGTTTCCTGACGGAATATGTAATTTGTTTTGTTATTAGACAACGTTTAATACTT[C/T]
AAATGTGTGTCCGTATATCCGATGTGACACGTAGGAGTAAATTTTTTTTTGCCAACTACACAAGGTCTAATTATTTATAGGAATAATGTCACATAGTACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.80% | 5.50% | 0.74% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.10% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 81.40% | 16.70% | 1.92% | 0.00% | NA |
| Aus | 269 | 98.90% | 0.00% | 1.12% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.00% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 95.60% | 3.10% | 1.30% | 0.00% | NA |
| Tropical Japonica | 504 | 55.20% | 42.30% | 2.58% | 0.00% | NA |
| Japonica Intermediate | 241 | 91.30% | 6.20% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0235437287 | G -> A | LOC_Os02g57860.1 | upstream_gene_variant ; 4447.0bp to feature; MODIFIER | silent_mutation | Average:47.628; most accessible tissue: Callus, score: 89.384 | N | N | N | N |
| vg0235437287 | G -> A | LOC_Os02g57870.1 | upstream_gene_variant ; 1419.0bp to feature; MODIFIER | silent_mutation | Average:47.628; most accessible tissue: Callus, score: 89.384 | N | N | N | N |
| vg0235437287 | G -> A | LOC_Os02g57870.2 | upstream_gene_variant ; 1440.0bp to feature; MODIFIER | silent_mutation | Average:47.628; most accessible tissue: Callus, score: 89.384 | N | N | N | N |
| vg0235437287 | G -> A | LOC_Os02g57880.1 | downstream_gene_variant ; 454.0bp to feature; MODIFIER | silent_mutation | Average:47.628; most accessible tissue: Callus, score: 89.384 | N | N | N | N |
| vg0235437287 | G -> A | LOC_Os02g57890.1 | downstream_gene_variant ; 3639.0bp to feature; MODIFIER | silent_mutation | Average:47.628; most accessible tissue: Callus, score: 89.384 | N | N | N | N |
| vg0235437287 | G -> A | LOC_Os02g57870-LOC_Os02g57880 | intergenic_region ; MODIFIER | silent_mutation | Average:47.628; most accessible tissue: Callus, score: 89.384 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0235437287 | 5.03E-06 | NA | mr1188 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235437287 | NA | 5.00E-07 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235437287 | 4.89E-06 | NA | mr1448 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235437287 | NA | 5.00E-08 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235437287 | NA | 1.57E-07 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235437287 | NA | 4.44E-11 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235437287 | NA | 1.17E-13 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235437287 | NA | 1.65E-06 | mr1194_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235437287 | NA | 2.00E-06 | mr1248_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235437287 | 3.75E-07 | 2.80E-15 | mr1769_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235437287 | NA | 8.20E-17 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235437287 | NA | 4.53E-09 | mr1862_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |