\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235437287:

Variant ID: vg0235437287 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 35437287
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


TGTACTATGTGACATTATTCCTATAAATAATTAGACCTTGTGTAGTTGGCAAAAAAAAATTTACTCCTACGTGTCACATCGGATATACGGACACACATTT[G/A]
AAGTATTAAACGTTGTCTAATAACAAAACAAATTACATATTCCGTCAGGAAACTGCGAGACGAATTTATTAAACCTAATTAATCCGTCATTAGCAAAAGT

Reverse complement sequence

ACTTTTGCTAATGACGGATTAATTAGGTTTAATAAATTCGTCTCGCAGTTTCCTGACGGAATATGTAATTTGTTTTGTTATTAGACAACGTTTAATACTT[C/T]
AAATGTGTGTCCGTATATCCGATGTGACACGTAGGAGTAAATTTTTTTTTGCCAACTACACAAGGTCTAATTATTTATAGGAATAATGTCACATAGTACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.80% 5.50% 0.74% 0.00% NA
All Indica  2759 99.80% 0.10% 0.11% 0.00% NA
All Japonica  1512 81.40% 16.70% 1.92% 0.00% NA
Aus  269 98.90% 0.00% 1.12% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.00% 0.25% 0.00% NA
Temperate Japonica  767 95.60% 3.10% 1.30% 0.00% NA
Tropical Japonica  504 55.20% 42.30% 2.58% 0.00% NA
Japonica Intermediate  241 91.30% 6.20% 2.49% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0235437287 G -> A LOC_Os02g57860.1 upstream_gene_variant ; 4447.0bp to feature; MODIFIER silent_mutation Average:47.628; most accessible tissue: Callus, score: 89.384 N N N N
vg0235437287 G -> A LOC_Os02g57870.1 upstream_gene_variant ; 1419.0bp to feature; MODIFIER silent_mutation Average:47.628; most accessible tissue: Callus, score: 89.384 N N N N
vg0235437287 G -> A LOC_Os02g57870.2 upstream_gene_variant ; 1440.0bp to feature; MODIFIER silent_mutation Average:47.628; most accessible tissue: Callus, score: 89.384 N N N N
vg0235437287 G -> A LOC_Os02g57880.1 downstream_gene_variant ; 454.0bp to feature; MODIFIER silent_mutation Average:47.628; most accessible tissue: Callus, score: 89.384 N N N N
vg0235437287 G -> A LOC_Os02g57890.1 downstream_gene_variant ; 3639.0bp to feature; MODIFIER silent_mutation Average:47.628; most accessible tissue: Callus, score: 89.384 N N N N
vg0235437287 G -> A LOC_Os02g57870-LOC_Os02g57880 intergenic_region ; MODIFIER silent_mutation Average:47.628; most accessible tissue: Callus, score: 89.384 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0235437287 5.03E-06 NA mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235437287 NA 5.00E-07 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235437287 4.89E-06 NA mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235437287 NA 5.00E-08 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235437287 NA 1.57E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235437287 NA 4.44E-11 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235437287 NA 1.17E-13 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235437287 NA 1.65E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235437287 NA 2.00E-06 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235437287 3.75E-07 2.80E-15 mr1769_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235437287 NA 8.20E-17 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235437287 NA 4.53E-09 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251