\
| Variant ID: vg0235365192 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 35365192 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 318. )
ATTATGAATCCTGTTCAAGTAGATGATCAGACCATTTCAGTACATTGAGGAGAAGCTCTGTGCAAGATATGGTTTAGCAGGACATTGTTTTTTTTTTATG[A/G]
TTTATGCAGGATTTTGTACTATCGTCAAGCTAAAACTTCTTTTATACTTAATTCCTACAGAAGCACTGTAATCTGAAGGACTGAAACTACTTTTAAAACT
AGTTTTAAAAGTAGTTTCAGTCCTTCAGATTACAGTGCTTCTGTAGGAATTAAGTATAAAAGAAGTTTTAGCTTGACGATAGTACAAAATCCTGCATAAA[T/C]
CATAAAAAAAAAACAATGTCCTGCTAAACCATATCTTGCACAGAGCTTCTCCTCAATGTACTGAAATGGTCTGATCATCTACTTGAACAGGATTCATAAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.20% | 2.60% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 92.40% | 7.10% | 0.46% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 78.60% | 20.40% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 1.70% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0235365192 | A -> G | LOC_Os02g57750.1 | intron_variant ; MODIFIER | silent_mutation | Average:57.46; most accessible tissue: Zhenshan97 flower, score: 87.365 | N | N | N | N |
| vg0235365192 | A -> G | LOC_Os02g57750.2 | intron_variant ; MODIFIER | silent_mutation | Average:57.46; most accessible tissue: Zhenshan97 flower, score: 87.365 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0235365192 | 4.85E-09 | 2.92E-11 | mr1125 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235365192 | 1.14E-08 | 5.84E-15 | mr1136 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235365192 | 2.55E-11 | 1.92E-14 | mr1188 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235365192 | 7.34E-09 | 1.54E-11 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235365192 | NA | 2.71E-07 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235365192 | 3.87E-09 | 9.16E-14 | mr1125_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235365192 | 8.43E-06 | 8.64E-11 | mr1136_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235365192 | 4.07E-09 | 7.16E-16 | mr1188_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235365192 | 2.91E-07 | 2.91E-07 | mr1448_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |