\
| Variant ID: vg0235325400 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 35325400 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 286. )
GAGCAAGTGCAGGTGGCGCCTGACGCTGCAAGCGCCGCGGTGATAGCACAGTAAGTGCGCCCTTACTGAAGATTCTATGTATCAGTCAATATTTGACACT[T/G]
ACGAAAAAATGGCACATTTCACCTTCTTTACATGTCAAAATTCTTGCAGGCAAAACAGCGGAAAGGCCCATTCAATATCAGTGACAAGTGAACCAACTTC
GAAGTTGGTTCACTTGTCACTGATATTGAATGGGCCTTTCCGCTGTTTTGCCTGCAAGAATTTTGACATGTAAAGAAGGTGAAATGTGCCATTTTTTCGT[A/C]
AGTGTCAAATATTGACTGATACATAGAATCTTCAGTAAGGGCGCACTTACTGTGCTATCACCGCGGCGCTTGCAGCGTCAGGCGCCACCTGCACTTGCTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.50% | 25.50% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 25.00% | 74.90% | 0.13% | 0.00% | NA |
| Aus | 269 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 12.50% | 87.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 31.20% | 68.70% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 51.90% | 48.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0235325400 | T -> G | LOC_Os02g57670.1 | upstream_gene_variant ; 2413.0bp to feature; MODIFIER | silent_mutation | Average:72.58; most accessible tissue: Minghui63 root, score: 83.939 | N | N | N | N |
| vg0235325400 | T -> G | LOC_Os02g57690.2 | downstream_gene_variant ; 1160.0bp to feature; MODIFIER | silent_mutation | Average:72.58; most accessible tissue: Minghui63 root, score: 83.939 | N | N | N | N |
| vg0235325400 | T -> G | LOC_Os02g57690.1 | downstream_gene_variant ; 211.0bp to feature; MODIFIER | silent_mutation | Average:72.58; most accessible tissue: Minghui63 root, score: 83.939 | N | N | N | N |
| vg0235325400 | T -> G | LOC_Os02g57690.4 | downstream_gene_variant ; 213.0bp to feature; MODIFIER | silent_mutation | Average:72.58; most accessible tissue: Minghui63 root, score: 83.939 | N | N | N | N |
| vg0235325400 | T -> G | LOC_Os02g57690.3 | downstream_gene_variant ; 213.0bp to feature; MODIFIER | silent_mutation | Average:72.58; most accessible tissue: Minghui63 root, score: 83.939 | N | N | N | N |
| vg0235325400 | T -> G | LOC_Os02g57670-LOC_Os02g57690 | intergenic_region ; MODIFIER | silent_mutation | Average:72.58; most accessible tissue: Minghui63 root, score: 83.939 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0235325400 | NA | 2.73E-17 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235325400 | NA | 9.13E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235325400 | NA | 5.45E-15 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235325400 | NA | 2.09E-22 | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235325400 | NA | 2.15E-23 | mr1917 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235325400 | NA | 4.63E-22 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235325400 | 2.70E-06 | 1.70E-20 | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235325400 | NA | 3.37E-06 | mr1114_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235325400 | 2.63E-07 | NA | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235325400 | NA | 1.24E-06 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235325400 | 2.23E-07 | 3.04E-16 | mr1118_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235325400 | 2.22E-06 | NA | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235325400 | NA | 1.82E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235325400 | 1.09E-07 | 2.35E-20 | mr1240_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235325400 | NA | 1.27E-06 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235325400 | 3.76E-06 | 4.65E-26 | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235325400 | NA | 1.18E-12 | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235325400 | 6.63E-06 | NA | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235325400 | 4.05E-07 | 5.95E-17 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235325400 | NA | 2.40E-06 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235325400 | NA | 7.81E-26 | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235325400 | NA | 2.67E-21 | mr1968_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |