\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235325400:

Variant ID: vg0235325400 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 35325400
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


GAGCAAGTGCAGGTGGCGCCTGACGCTGCAAGCGCCGCGGTGATAGCACAGTAAGTGCGCCCTTACTGAAGATTCTATGTATCAGTCAATATTTGACACT[T/G]
ACGAAAAAATGGCACATTTCACCTTCTTTACATGTCAAAATTCTTGCAGGCAAAACAGCGGAAAGGCCCATTCAATATCAGTGACAAGTGAACCAACTTC

Reverse complement sequence

GAAGTTGGTTCACTTGTCACTGATATTGAATGGGCCTTTCCGCTGTTTTGCCTGCAAGAATTTTGACATGTAAAGAAGGTGAAATGTGCCATTTTTTCGT[A/C]
AGTGTCAAATATTGACTGATACATAGAATCTTCAGTAAGGGCGCACTTACTGTGCTATCACCGCGGCGCTTGCAGCGTCAGGCGCCACCTGCACTTGCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.50% 25.50% 0.04% 0.00% NA
All Indica  2759 99.20% 0.80% 0.00% 0.00% NA
All Japonica  1512 25.00% 74.90% 0.13% 0.00% NA
Aus  269 93.30% 6.70% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.70% 0.00% 0.00% NA
Temperate Japonica  767 12.50% 87.40% 0.13% 0.00% NA
Tropical Japonica  504 31.20% 68.70% 0.20% 0.00% NA
Japonica Intermediate  241 51.90% 48.10% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0235325400 T -> G LOC_Os02g57670.1 upstream_gene_variant ; 2413.0bp to feature; MODIFIER silent_mutation Average:72.58; most accessible tissue: Minghui63 root, score: 83.939 N N N N
vg0235325400 T -> G LOC_Os02g57690.2 downstream_gene_variant ; 1160.0bp to feature; MODIFIER silent_mutation Average:72.58; most accessible tissue: Minghui63 root, score: 83.939 N N N N
vg0235325400 T -> G LOC_Os02g57690.1 downstream_gene_variant ; 211.0bp to feature; MODIFIER silent_mutation Average:72.58; most accessible tissue: Minghui63 root, score: 83.939 N N N N
vg0235325400 T -> G LOC_Os02g57690.4 downstream_gene_variant ; 213.0bp to feature; MODIFIER silent_mutation Average:72.58; most accessible tissue: Minghui63 root, score: 83.939 N N N N
vg0235325400 T -> G LOC_Os02g57690.3 downstream_gene_variant ; 213.0bp to feature; MODIFIER silent_mutation Average:72.58; most accessible tissue: Minghui63 root, score: 83.939 N N N N
vg0235325400 T -> G LOC_Os02g57670-LOC_Os02g57690 intergenic_region ; MODIFIER silent_mutation Average:72.58; most accessible tissue: Minghui63 root, score: 83.939 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0235325400 NA 2.73E-17 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400 NA 9.13E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400 NA 5.45E-15 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400 NA 2.09E-22 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400 NA 2.15E-23 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400 NA 4.63E-22 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400 2.70E-06 1.70E-20 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400 NA 3.37E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400 2.63E-07 NA mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400 NA 1.24E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400 2.23E-07 3.04E-16 mr1118_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400 2.22E-06 NA mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400 NA 1.82E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400 1.09E-07 2.35E-20 mr1240_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400 NA 1.27E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400 3.76E-06 4.65E-26 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400 NA 1.18E-12 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400 6.63E-06 NA mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400 4.05E-07 5.95E-17 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400 NA 2.40E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400 NA 7.81E-26 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400 NA 2.67E-21 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251