Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235325400:

Variant ID: vg0235325400 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 35325400
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

GAGCAAGTGCAGGTGGCGCCTGACGCTGCAAGCGCCGCGGTGATAGCACAGTAAGTGCGCCCTTACTGAAGATTCTATGTATCAGTCAATATTTGACACT[T/G]
ACGAAAAAATGGCACATTTCACCTTCTTTACATGTCAAAATTCTTGCAGGCAAAACAGCGGAAAGGCCCATTCAATATCAGTGACAAGTGAACCAACTTC

Reverse complement sequence

GAAGTTGGTTCACTTGTCACTGATATTGAATGGGCCTTTCCGCTGTTTTGCCTGCAAGAATTTTGACATGTAAAGAAGGTGAAATGTGCCATTTTTTCGT[A/C]
AGTGTCAAATATTGACTGATACATAGAATCTTCAGTAAGGGCGCACTTACTGTGCTATCACCGCGGCGCTTGCAGCGTCAGGCGCCACCTGCACTTGCTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.50%	25.50%	0.04%	0.00%	NA
All Indica	2759	99.20%	0.80%	0.00%	0.00%	NA
All Japonica	1512	25.00%	74.90%	0.13%	0.00%	NA
Aus	269	93.30%	6.70%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	98.30%	1.70%	0.00%	0.00%	NA
Temperate Japonica	767	12.50%	87.40%	0.13%	0.00%	NA
Tropical Japonica	504	31.20%	68.70%	0.20%	0.00%	NA
Japonica Intermediate	241	51.90%	48.10%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	66.70%	33.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0235325400	T -> G	LOC_Os02g57670.1	upstream_gene_variant ; 2413.0bp to feature; MODIFIER	silent_mutation	Average:72.58; most accessible tissue: Minghui63 root, score: 83.939	N	N	N	N
vg0235325400	T -> G	LOC_Os02g57690.2	downstream_gene_variant ; 1160.0bp to feature; MODIFIER	silent_mutation	Average:72.58; most accessible tissue: Minghui63 root, score: 83.939	N	N	N	N
vg0235325400	T -> G	LOC_Os02g57690.1	downstream_gene_variant ; 211.0bp to feature; MODIFIER	silent_mutation	Average:72.58; most accessible tissue: Minghui63 root, score: 83.939	N	N	N	N
vg0235325400	T -> G	LOC_Os02g57690.4	downstream_gene_variant ; 213.0bp to feature; MODIFIER	silent_mutation	Average:72.58; most accessible tissue: Minghui63 root, score: 83.939	N	N	N	N
vg0235325400	T -> G	LOC_Os02g57690.3	downstream_gene_variant ; 213.0bp to feature; MODIFIER	silent_mutation	Average:72.58; most accessible tissue: Minghui63 root, score: 83.939	N	N	N	N
vg0235325400	T -> G	LOC_Os02g57670-LOC_Os02g57690	intergenic_region ; MODIFIER	silent_mutation	Average:72.58; most accessible tissue: Minghui63 root, score: 83.939	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0235325400	NA	2.73E-17	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400	NA	9.13E-06	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400	NA	5.45E-15	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400	NA	2.09E-22	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400	NA	2.15E-23	mr1917	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400	NA	4.63E-22	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400	2.70E-06	1.70E-20	mr1114_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400	NA	3.37E-06	mr1114_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400	2.63E-07	NA	mr1117_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400	NA	1.24E-06	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400	2.23E-07	3.04E-16	mr1118_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400	2.22E-06	NA	mr1119_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400	NA	1.82E-06	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400	1.09E-07	2.35E-20	mr1240_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400	NA	1.27E-06	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400	3.76E-06	4.65E-26	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400	NA	1.18E-12	mr1258_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400	6.63E-06	NA	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400	4.05E-07	5.95E-17	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400	NA	2.40E-06	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400	NA	7.81E-26	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235325400	NA	2.67E-21	mr1968_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251