\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235323589:

Variant ID: vg0235323589 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 35323589
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


ATTAAGAGAAACACTCAGGGGTCTTCCGGCTAGCTCCACAAGGTGATAGCCTAAATGACCTGGATTCGTAACCTCACCCCTTCTAATTATTTGATATTAG[G/A]
TCCTTCACTAATATTCATGTTATAACATAAATCGAGAAATATATTATTATAACACTATTTTGGTGCTATCTTGAAACTCAACGATACATCACTAGCTACC

Reverse complement sequence

GGTAGCTAGTGATGTATCGTTGAGTTTCAAGATAGCACCAAAATAGTGTTATAATAATATATTTCTCGATTTATGTTATAACATGAATATTAGTGAAGGA[C/T]
CTAATATCAAATAATTAGAAGGGGTGAGGTTACGAATCCAGGTCATTTAGGCTATCACCTTGTGGAGCTAGCCGGAAGACCCCTGAGTGTTTCTCTTAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.00% 8.90% 0.11% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 73.00% 26.70% 0.33% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 91.90% 7.80% 0.26% 0.00% NA
Tropical Japonica  504 44.40% 55.00% 0.60% 0.00% NA
Japonica Intermediate  241 72.60% 27.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0235323589 G -> A LOC_Os02g57670.1 upstream_gene_variant ; 602.0bp to feature; MODIFIER silent_mutation Average:62.57; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0235323589 G -> A LOC_Os02g57690.2 downstream_gene_variant ; 2971.0bp to feature; MODIFIER silent_mutation Average:62.57; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0235323589 G -> A LOC_Os02g57690.1 downstream_gene_variant ; 2022.0bp to feature; MODIFIER silent_mutation Average:62.57; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0235323589 G -> A LOC_Os02g57690.4 downstream_gene_variant ; 2024.0bp to feature; MODIFIER silent_mutation Average:62.57; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0235323589 G -> A LOC_Os02g57690.3 downstream_gene_variant ; 2024.0bp to feature; MODIFIER silent_mutation Average:62.57; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0235323589 G -> A LOC_Os02g57670-LOC_Os02g57690 intergenic_region ; MODIFIER silent_mutation Average:62.57; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0235323589 9.02E-07 NA mr1125 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235323589 1.85E-06 NA mr1448 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235323589 5.24E-06 NA mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235323589 NA 2.15E-19 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235323589 NA 9.05E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235323589 NA 8.26E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235323589 NA 1.26E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235323589 NA 1.05E-07 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235323589 NA 3.63E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235323589 NA 8.56E-12 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235323589 NA 5.46E-14 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235323589 NA 4.03E-10 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235323589 NA 1.49E-23 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251