Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0235323589:

Variant ID: vg0235323589 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 35323589
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

ATTAAGAGAAACACTCAGGGGTCTTCCGGCTAGCTCCACAAGGTGATAGCCTAAATGACCTGGATTCGTAACCTCACCCCTTCTAATTATTTGATATTAG[G/A]
TCCTTCACTAATATTCATGTTATAACATAAATCGAGAAATATATTATTATAACACTATTTTGGTGCTATCTTGAAACTCAACGATACATCACTAGCTACC

Reverse complement sequence

GGTAGCTAGTGATGTATCGTTGAGTTTCAAGATAGCACCAAAATAGTGTTATAATAATATATTTCTCGATTTATGTTATAACATGAATATTAGTGAAGGA[C/T]
CTAATATCAAATAATTAGAAGGGGTGAGGTTACGAATCCAGGTCATTTAGGCTATCACCTTGTGGAGCTAGCCGGAAGACCCCTGAGTGTTTCTCTTAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.00%	8.90%	0.11%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	73.00%	26.70%	0.33%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	91.90%	7.80%	0.26%	0.00%	NA
Tropical Japonica	504	44.40%	55.00%	0.60%	0.00%	NA
Japonica Intermediate	241	72.60%	27.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0235323589	G -> A	LOC_Os02g57670.1	upstream_gene_variant ; 602.0bp to feature; MODIFIER	silent_mutation	Average:62.57; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0235323589	G -> A	LOC_Os02g57690.2	downstream_gene_variant ; 2971.0bp to feature; MODIFIER	silent_mutation	Average:62.57; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0235323589	G -> A	LOC_Os02g57690.1	downstream_gene_variant ; 2022.0bp to feature; MODIFIER	silent_mutation	Average:62.57; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0235323589	G -> A	LOC_Os02g57690.4	downstream_gene_variant ; 2024.0bp to feature; MODIFIER	silent_mutation	Average:62.57; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0235323589	G -> A	LOC_Os02g57690.3	downstream_gene_variant ; 2024.0bp to feature; MODIFIER	silent_mutation	Average:62.57; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0235323589	G -> A	LOC_Os02g57670-LOC_Os02g57690	intergenic_region ; MODIFIER	silent_mutation	Average:62.57; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0235323589	9.02E-07	NA	mr1125	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235323589	1.85E-06	NA	mr1448	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235323589	5.24E-06	NA	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235323589	NA	2.15E-19	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235323589	NA	9.05E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235323589	NA	8.26E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235323589	NA	1.26E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235323589	NA	1.05E-07	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235323589	NA	3.63E-07	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235323589	NA	8.56E-12	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235323589	NA	5.46E-14	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235323589	NA	4.03E-10	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235323589	NA	1.49E-23	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251