\
| Variant ID: vg0235323589 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 35323589 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 218. )
ATTAAGAGAAACACTCAGGGGTCTTCCGGCTAGCTCCACAAGGTGATAGCCTAAATGACCTGGATTCGTAACCTCACCCCTTCTAATTATTTGATATTAG[G/A]
TCCTTCACTAATATTCATGTTATAACATAAATCGAGAAATATATTATTATAACACTATTTTGGTGCTATCTTGAAACTCAACGATACATCACTAGCTACC
GGTAGCTAGTGATGTATCGTTGAGTTTCAAGATAGCACCAAAATAGTGTTATAATAATATATTTCTCGATTTATGTTATAACATGAATATTAGTGAAGGA[C/T]
CTAATATCAAATAATTAGAAGGGGTGAGGTTACGAATCCAGGTCATTTAGGCTATCACCTTGTGGAGCTAGCCGGAAGACCCCTGAGTGTTTCTCTTAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.00% | 8.90% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 73.00% | 26.70% | 0.33% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 91.90% | 7.80% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 44.40% | 55.00% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 72.60% | 27.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0235323589 | G -> A | LOC_Os02g57670.1 | upstream_gene_variant ; 602.0bp to feature; MODIFIER | silent_mutation | Average:62.57; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg0235323589 | G -> A | LOC_Os02g57690.2 | downstream_gene_variant ; 2971.0bp to feature; MODIFIER | silent_mutation | Average:62.57; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg0235323589 | G -> A | LOC_Os02g57690.1 | downstream_gene_variant ; 2022.0bp to feature; MODIFIER | silent_mutation | Average:62.57; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg0235323589 | G -> A | LOC_Os02g57690.4 | downstream_gene_variant ; 2024.0bp to feature; MODIFIER | silent_mutation | Average:62.57; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg0235323589 | G -> A | LOC_Os02g57690.3 | downstream_gene_variant ; 2024.0bp to feature; MODIFIER | silent_mutation | Average:62.57; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg0235323589 | G -> A | LOC_Os02g57670-LOC_Os02g57690 | intergenic_region ; MODIFIER | silent_mutation | Average:62.57; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0235323589 | 9.02E-07 | NA | mr1125 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235323589 | 1.85E-06 | NA | mr1448 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235323589 | 5.24E-06 | NA | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235323589 | NA | 2.15E-19 | mr1042_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235323589 | NA | 9.05E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235323589 | NA | 8.26E-06 | mr1420_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235323589 | NA | 1.26E-06 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235323589 | NA | 1.05E-07 | mr1502_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235323589 | NA | 3.63E-07 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235323589 | NA | 8.56E-12 | mr1680_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235323589 | NA | 5.46E-14 | mr1742_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235323589 | NA | 4.03E-10 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235323589 | NA | 1.49E-23 | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |