Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235315290:

Variant ID: vg0235315290 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 35315290
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATATATTTTTTAATAAGATAAATGCTCAAATATATCTTGAAAAAATCAACAGCGTTATATATTAAAAAATTAAAAAAAACAGATAGAGTATTTATTTAG[G/A]
GGGTAACATAGAGGGGATATTTACATTCGTTTGAGCAAGTGACAGTAAAGAAACAAAAAGAAGGAACAAACCAACAAGGTCATTTTCGATAGGCTACGCA

Reverse complement sequence

TGCGTAGCCTATCGAAAATGACCTTGTTGGTTTGTTCCTTCTTTTTGTTTCTTTACTGTCACTTGCTCAAACGAATGTAAATATCCCCTCTATGTTACCC[C/T]
CTAAATAAATACTCTATCTGTTTTTTTTAATTTTTTAATATATAACGCTGTTGATTTTTTCAAGATATATTTGAGCATTTATCTTATTAAAAAATATATA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.30%	20.50%	0.15%	0.00%	NA
All Indica	2759	99.00%	0.90%	0.04%	0.00%	NA
All Japonica	1512	40.00%	59.70%	0.26%	0.00%	NA
Aus	269	96.30%	3.00%	0.74%	0.00%	NA
Indica I	595	99.30%	0.50%	0.17%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	98.90%	1.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.70%	1.30%	0.00%	0.00%	NA
Temperate Japonica	767	15.80%	84.00%	0.26%	0.00%	NA
Tropical Japonica	504	65.10%	34.70%	0.20%	0.00%	NA
Japonica Intermediate	241	64.70%	34.90%	0.41%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	73.30%	26.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0235315290	G -> A	LOC_Os02g57660.1	upstream_gene_variant ; 1655.0bp to feature; MODIFIER	silent_mutation	Average:73.779; most accessible tissue: Minghui63 root, score: 90.51	N	N	N	N
vg0235315290	G -> A	LOC_Os02g57660.2	upstream_gene_variant ; 1706.0bp to feature; MODIFIER	silent_mutation	Average:73.779; most accessible tissue: Minghui63 root, score: 90.51	N	N	N	N
vg0235315290	G -> A	LOC_Os02g57660-LOC_Os02g57670	intergenic_region ; MODIFIER	silent_mutation	Average:73.779; most accessible tissue: Minghui63 root, score: 90.51	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0235315290	NA	4.06E-16	mr1013	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235315290	NA	5.85E-14	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235315290	NA	4.72E-13	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235315290	NA	8.62E-14	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235315290	2.47E-06	2.23E-25	mr1010_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235315290	NA	1.24E-07	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235315290	NA	1.29E-10	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235315290	4.72E-07	1.04E-21	mr1013_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235315290	NA	5.66E-08	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235315290	NA	2.04E-17	mr1031_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235315290	NA	8.28E-08	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235315290	NA	1.73E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235315290	NA	3.25E-06	mr1091_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235315290	NA	5.07E-07	mr1194_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235315290	NA	5.79E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235315290	NA	7.99E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235315290	NA	1.62E-11	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251