Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235270915:

Variant ID: vg0235270915 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 35270915
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGTTCCCCAAATTATTTTCCCCAAAACATCACATCGAATCTTTGTACACATACATAAAGTATTAAATATAGATAAAAAGAAAAACTAATTGCACAGTTAT[A/G]
GAGGAAATCGTGAGACAAATCTTTTAAGCCTAATTAATCCGTGATTAGCCATAAGTGCTACAGTAACCCACATGTGCTAATGATGGCTTAATTAGTCTCA

Reverse complement sequence

TGAGACTAATTAAGCCATCATTAGCACATGTGGGTTACTGTAGCACTTATGGCTAATCACGGATTAATTAGGCTTAAAAGATTTGTCTCACGATTTCCTC[T/C]
ATAACTGTGCAATTAGTTTTTCTTTTTATCTATATTTAATACTTTATGTATGTGTACAAAGATTCGATGTGATGTTTTGGGGAAAATAATTTGGGGAACT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.20%	26.20%	2.29%	2.33%	NA
All Indica	2759	90.10%	2.70%	3.48%	3.70%	NA
All Japonica	1512	24.90%	74.50%	0.40%	0.20%	NA
Aus	269	94.80%	2.20%	1.86%	1.12%	NA
Indica I	595	92.80%	4.50%	2.02%	0.67%	NA
Indica II	465	82.20%	0.90%	5.59%	11.40%	NA
Indica III	913	92.00%	3.10%	2.41%	2.52%	NA
Indica Intermediate	786	90.60%	2.00%	4.58%	2.80%	NA
Temperate Japonica	767	7.70%	91.50%	0.52%	0.26%	NA
Tropical Japonica	504	43.30%	56.20%	0.40%	0.20%	NA
Japonica Intermediate	241	41.50%	58.50%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	67.80%	28.90%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0235270915	A -> G	LOC_Os02g57590.1	upstream_gene_variant ; 672.0bp to feature; MODIFIER	silent_mutation	Average:65.825; most accessible tissue: Minghui63 panicle, score: 91.756	N	N	N	N
vg0235270915	A -> G	LOC_Os02g57600.2	upstream_gene_variant ; 4357.0bp to feature; MODIFIER	silent_mutation	Average:65.825; most accessible tissue: Minghui63 panicle, score: 91.756	N	N	N	N
vg0235270915	A -> G	LOC_Os02g57590.2	upstream_gene_variant ; 672.0bp to feature; MODIFIER	silent_mutation	Average:65.825; most accessible tissue: Minghui63 panicle, score: 91.756	N	N	N	N
vg0235270915	A -> G	LOC_Os02g57600.1	upstream_gene_variant ; 4227.0bp to feature; MODIFIER	silent_mutation	Average:65.825; most accessible tissue: Minghui63 panicle, score: 91.756	N	N	N	N
vg0235270915	A -> G	LOC_Os02g57570.1	downstream_gene_variant ; 2085.0bp to feature; MODIFIER	silent_mutation	Average:65.825; most accessible tissue: Minghui63 panicle, score: 91.756	N	N	N	N
vg0235270915	A -> G	LOC_Os02g57580.1	downstream_gene_variant ; 658.0bp to feature; MODIFIER	silent_mutation	Average:65.825; most accessible tissue: Minghui63 panicle, score: 91.756	N	N	N	N
vg0235270915	A -> G	LOC_Os02g57580-LOC_Os02g57590	intergenic_region ; MODIFIER	silent_mutation	Average:65.825; most accessible tissue: Minghui63 panicle, score: 91.756	N	N	N	N
vg0235270915	A -> DEL	N	N	silent_mutation	Average:65.825; most accessible tissue: Minghui63 panicle, score: 91.756	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0235270915	A	G	0.0	-0.01	-0.01	-0.01	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0235270915	5.86E-06	2.66E-11	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235270915	NA	2.70E-07	mr1190	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235270915	NA	1.61E-35	mr1448	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235270915	NA	7.92E-12	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235270915	NA	1.46E-14	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235270915	NA	1.05E-61	mr1125_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235270915	NA	4.86E-35	mr1448_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235270915	1.71E-06	4.33E-07	mr1517_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235270915	NA	3.39E-57	mr1695_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251