\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235267445:

Variant ID: vg0235267445 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 35267445
Reference Allele: CAlternative Allele: T,G,CTTTAAA
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.06, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TAAATTTATTATGAAAATATATTTAATTATTGGTTAGATGAAACTAATTTAATAATATAAATATTATTATACTTGTCTATAAACTTAGTTAAACTTTAAA[C/T,G,CTTTAAA]
TTTAAATTTAACGTTTTATAAGCTGATACGGATGGAGTAACAAACATAAATCAGTTGAGAGTGAGAGGGACGTGGAAAAGTAGAGCCATCCGCGCTAAAA

Reverse complement sequence

TTTTAGCGCGGATGGCTCTACTTTTCCACGTCCCTCTCACTCTCAACTGATTTATGTTTGTTACTCCATCCGTATCAGCTTATAAAACGTTAAATTTAAA[G/A,C,TTTAAAG]
TTTAAAGTTTAACTAAGTTTATAGACAAGTATAATAATATTTATATTATTAAATTAGTTTCATCTAACCAATAATTAAATATATTTTCATAATAAATTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.60% 40.00% 3.94% 1.14% G: 0.28%; CTTTAAA: 0.08%
All Indica  2759 44.30% 54.20% 0.87% 0.04% G: 0.47%; CTTTAAA: 0.14%
All Japonica  1512 77.80% 8.80% 9.99% 3.37% NA
Aus  269 24.50% 74.70% 0.74% 0.00% NA
Indica I  595 24.50% 74.60% 0.84% 0.00% NA
Indica II  465 66.70% 32.70% 0.65% 0.00% NA
Indica III  913 45.20% 52.60% 0.44% 0.00% G: 1.31%; CTTTAAA: 0.44%
Indica Intermediate  786 45.00% 53.20% 1.53% 0.13% G: 0.13%
Temperate Japonica  767 70.50% 4.60% 18.51% 6.39% NA
Tropical Japonica  504 95.20% 4.40% 0.20% 0.20% NA
Japonica Intermediate  241 64.70% 31.50% 3.32% 0.41% NA
VI/Aromatic  96 68.80% 30.20% 1.04% 0.00% NA
Intermediate  90 53.30% 35.60% 8.89% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0235267445 C -> G LOC_Os02g57560.1 upstream_gene_variant ; 2052.0bp to feature; MODIFIER silent_mutation Average:92.416; most accessible tissue: Zhenshan97 flag leaf, score: 96.096 N N N N
vg0235267445 C -> G LOC_Os02g57570.1 upstream_gene_variant ; 215.0bp to feature; MODIFIER silent_mutation Average:92.416; most accessible tissue: Zhenshan97 flag leaf, score: 96.096 N N N N
vg0235267445 C -> G LOC_Os02g57580.1 upstream_gene_variant ; 1773.0bp to feature; MODIFIER silent_mutation Average:92.416; most accessible tissue: Zhenshan97 flag leaf, score: 96.096 N N N N
vg0235267445 C -> G LOC_Os02g57590.1 upstream_gene_variant ; 4142.0bp to feature; MODIFIER silent_mutation Average:92.416; most accessible tissue: Zhenshan97 flag leaf, score: 96.096 N N N N
vg0235267445 C -> G LOC_Os02g57590.2 upstream_gene_variant ; 4142.0bp to feature; MODIFIER silent_mutation Average:92.416; most accessible tissue: Zhenshan97 flag leaf, score: 96.096 N N N N
vg0235267445 C -> G LOC_Os02g57560-LOC_Os02g57570 intergenic_region ; MODIFIER silent_mutation Average:92.416; most accessible tissue: Zhenshan97 flag leaf, score: 96.096 N N N N
vg0235267445 C -> T LOC_Os02g57560.1 upstream_gene_variant ; 2052.0bp to feature; MODIFIER silent_mutation Average:92.416; most accessible tissue: Zhenshan97 flag leaf, score: 96.096 N N N N
vg0235267445 C -> T LOC_Os02g57570.1 upstream_gene_variant ; 215.0bp to feature; MODIFIER silent_mutation Average:92.416; most accessible tissue: Zhenshan97 flag leaf, score: 96.096 N N N N
vg0235267445 C -> T LOC_Os02g57580.1 upstream_gene_variant ; 1773.0bp to feature; MODIFIER silent_mutation Average:92.416; most accessible tissue: Zhenshan97 flag leaf, score: 96.096 N N N N
vg0235267445 C -> T LOC_Os02g57590.1 upstream_gene_variant ; 4142.0bp to feature; MODIFIER silent_mutation Average:92.416; most accessible tissue: Zhenshan97 flag leaf, score: 96.096 N N N N
vg0235267445 C -> T LOC_Os02g57590.2 upstream_gene_variant ; 4142.0bp to feature; MODIFIER silent_mutation Average:92.416; most accessible tissue: Zhenshan97 flag leaf, score: 96.096 N N N N
vg0235267445 C -> T LOC_Os02g57560-LOC_Os02g57570 intergenic_region ; MODIFIER silent_mutation Average:92.416; most accessible tissue: Zhenshan97 flag leaf, score: 96.096 N N N N
vg0235267445 C -> DEL N N silent_mutation Average:92.416; most accessible tissue: Zhenshan97 flag leaf, score: 96.096 N N N N
vg0235267445 C -> CTTTAAA LOC_Os02g57560.1 upstream_gene_variant ; 2053.0bp to feature; MODIFIER silent_mutation Average:92.416; most accessible tissue: Zhenshan97 flag leaf, score: 96.096 N N N N
vg0235267445 C -> CTTTAAA LOC_Os02g57570.1 upstream_gene_variant ; 214.0bp to feature; MODIFIER silent_mutation Average:92.416; most accessible tissue: Zhenshan97 flag leaf, score: 96.096 N N N N
vg0235267445 C -> CTTTAAA LOC_Os02g57580.1 upstream_gene_variant ; 1772.0bp to feature; MODIFIER silent_mutation Average:92.416; most accessible tissue: Zhenshan97 flag leaf, score: 96.096 N N N N
vg0235267445 C -> CTTTAAA LOC_Os02g57590.1 upstream_gene_variant ; 4141.0bp to feature; MODIFIER silent_mutation Average:92.416; most accessible tissue: Zhenshan97 flag leaf, score: 96.096 N N N N
vg0235267445 C -> CTTTAAA LOC_Os02g57590.2 upstream_gene_variant ; 4141.0bp to feature; MODIFIER silent_mutation Average:92.416; most accessible tissue: Zhenshan97 flag leaf, score: 96.096 N N N N
vg0235267445 C -> CTTTAAA LOC_Os02g57560-LOC_Os02g57570 intergenic_region ; MODIFIER silent_mutation Average:92.416; most accessible tissue: Zhenshan97 flag leaf, score: 96.096 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0235267445 C CTTTA* 0.02 0.1 0.08 -0.08 -0.04 -0.05
vg0235267445 C G 0.0 -0.01 -0.02 -0.02 -0.02 -0.02
vg0235267445 C T 0.01 0.02 0.01 0.0 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0235267445 NA 6.21E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235267445 NA 1.42E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235267445 NA 5.17E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235267445 NA 9.97E-06 mr1404_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235267445 1.81E-06 5.07E-06 mr1425_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235267445 NA 6.46E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251