\
| Variant ID: vg0235259448 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 35259448 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GCAGTCTGGCTCGAAGCGCTTCGCCCAATCGTCGCCGATTGGCAAGGGTAACCCACTAACCCCATCACAATTTCTTAATTATTATCATCACAAATTGGTT[G/A]
TAGGCTGGTTTCTCAAGTCCAAAATTTTAGGAAGTTAGGGTTCTGAAATATGAAGTTTCTCCCAATTTCTGTTACATAAACATAAATTTATTCTTTCTAG
CTAGAAAGAATAAATTTATGTTTATGTAACAGAAATTGGGAGAAACTTCATATTTCAGAACCCTAACTTCCTAAAATTTTGGACTTGAGAAACCAGCCTA[C/T]
AACCAATTTGTGATGATAATAATTAAGAAATTGTGATGGGGTTAGTGGGTTACCCTTGCCAATCGGCGACGATTGGGCGAAGCGCTTCGAGCCAGACTGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.50% | 29.20% | 2.14% | 0.23% | NA |
| All Indica | 2759 | 93.10% | 3.00% | 3.48% | 0.40% | NA |
| All Japonica | 1512 | 25.30% | 74.50% | 0.20% | 0.00% | NA |
| Aus | 269 | 53.50% | 45.70% | 0.74% | 0.00% | NA |
| Indica I | 595 | 94.60% | 3.20% | 2.18% | 0.00% | NA |
| Indica II | 465 | 94.20% | 2.20% | 3.66% | 0.00% | NA |
| Indica III | 913 | 92.90% | 2.80% | 3.18% | 1.10% | NA |
| Indica Intermediate | 786 | 91.60% | 3.60% | 4.71% | 0.13% | NA |
| Temperate Japonica | 767 | 8.20% | 91.50% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 43.70% | 56.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 41.10% | 58.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 40.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0235259448 | G -> A | LOC_Os02g57540.1 | upstream_gene_variant ; 1213.0bp to feature; MODIFIER | silent_mutation | Average:47.832; most accessible tissue: Minghui63 root, score: 77.29 | N | N | N | N |
| vg0235259448 | G -> A | LOC_Os02g57530.1 | downstream_gene_variant ; 3405.0bp to feature; MODIFIER | silent_mutation | Average:47.832; most accessible tissue: Minghui63 root, score: 77.29 | N | N | N | N |
| vg0235259448 | G -> A | LOC_Os02g57550.1 | downstream_gene_variant ; 1810.0bp to feature; MODIFIER | silent_mutation | Average:47.832; most accessible tissue: Minghui63 root, score: 77.29 | N | N | N | N |
| vg0235259448 | G -> A | LOC_Os02g57560.1 | downstream_gene_variant ; 3718.0bp to feature; MODIFIER | silent_mutation | Average:47.832; most accessible tissue: Minghui63 root, score: 77.29 | N | N | N | N |
| vg0235259448 | G -> A | LOC_Os02g57530.2 | downstream_gene_variant ; 3405.0bp to feature; MODIFIER | silent_mutation | Average:47.832; most accessible tissue: Minghui63 root, score: 77.29 | N | N | N | N |
| vg0235259448 | G -> A | LOC_Os02g57530.3 | downstream_gene_variant ; 3405.0bp to feature; MODIFIER | silent_mutation | Average:47.832; most accessible tissue: Minghui63 root, score: 77.29 | N | N | N | N |
| vg0235259448 | G -> A | LOC_Os02g57530.4 | downstream_gene_variant ; 3405.0bp to feature; MODIFIER | silent_mutation | Average:47.832; most accessible tissue: Minghui63 root, score: 77.29 | N | N | N | N |
| vg0235259448 | G -> A | LOC_Os02g57540-LOC_Os02g57550 | intergenic_region ; MODIFIER | silent_mutation | Average:47.832; most accessible tissue: Minghui63 root, score: 77.29 | N | N | N | N |
| vg0235259448 | G -> DEL | N | N | silent_mutation | Average:47.832; most accessible tissue: Minghui63 root, score: 77.29 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0235259448 | NA | 2.45E-06 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235259448 | 3.62E-07 | 1.55E-38 | mr1448 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235259448 | NA | 1.17E-63 | mr1125_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235259448 | NA | 5.77E-09 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235259448 | NA | 7.48E-07 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |