\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235259448:

Variant ID: vg0235259448 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 35259448
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAGTCTGGCTCGAAGCGCTTCGCCCAATCGTCGCCGATTGGCAAGGGTAACCCACTAACCCCATCACAATTTCTTAATTATTATCATCACAAATTGGTT[G/A]
TAGGCTGGTTTCTCAAGTCCAAAATTTTAGGAAGTTAGGGTTCTGAAATATGAAGTTTCTCCCAATTTCTGTTACATAAACATAAATTTATTCTTTCTAG

Reverse complement sequence

CTAGAAAGAATAAATTTATGTTTATGTAACAGAAATTGGGAGAAACTTCATATTTCAGAACCCTAACTTCCTAAAATTTTGGACTTGAGAAACCAGCCTA[C/T]
AACCAATTTGTGATGATAATAATTAAGAAATTGTGATGGGGTTAGTGGGTTACCCTTGCCAATCGGCGACGATTGGGCGAAGCGCTTCGAGCCAGACTGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.50% 29.20% 2.14% 0.23% NA
All Indica  2759 93.10% 3.00% 3.48% 0.40% NA
All Japonica  1512 25.30% 74.50% 0.20% 0.00% NA
Aus  269 53.50% 45.70% 0.74% 0.00% NA
Indica I  595 94.60% 3.20% 2.18% 0.00% NA
Indica II  465 94.20% 2.20% 3.66% 0.00% NA
Indica III  913 92.90% 2.80% 3.18% 1.10% NA
Indica Intermediate  786 91.60% 3.60% 4.71% 0.13% NA
Temperate Japonica  767 8.20% 91.50% 0.26% 0.00% NA
Tropical Japonica  504 43.70% 56.30% 0.00% 0.00% NA
Japonica Intermediate  241 41.10% 58.50% 0.41% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 60.00% 40.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0235259448 G -> A LOC_Os02g57540.1 upstream_gene_variant ; 1213.0bp to feature; MODIFIER silent_mutation Average:47.832; most accessible tissue: Minghui63 root, score: 77.29 N N N N
vg0235259448 G -> A LOC_Os02g57530.1 downstream_gene_variant ; 3405.0bp to feature; MODIFIER silent_mutation Average:47.832; most accessible tissue: Minghui63 root, score: 77.29 N N N N
vg0235259448 G -> A LOC_Os02g57550.1 downstream_gene_variant ; 1810.0bp to feature; MODIFIER silent_mutation Average:47.832; most accessible tissue: Minghui63 root, score: 77.29 N N N N
vg0235259448 G -> A LOC_Os02g57560.1 downstream_gene_variant ; 3718.0bp to feature; MODIFIER silent_mutation Average:47.832; most accessible tissue: Minghui63 root, score: 77.29 N N N N
vg0235259448 G -> A LOC_Os02g57530.2 downstream_gene_variant ; 3405.0bp to feature; MODIFIER silent_mutation Average:47.832; most accessible tissue: Minghui63 root, score: 77.29 N N N N
vg0235259448 G -> A LOC_Os02g57530.3 downstream_gene_variant ; 3405.0bp to feature; MODIFIER silent_mutation Average:47.832; most accessible tissue: Minghui63 root, score: 77.29 N N N N
vg0235259448 G -> A LOC_Os02g57530.4 downstream_gene_variant ; 3405.0bp to feature; MODIFIER silent_mutation Average:47.832; most accessible tissue: Minghui63 root, score: 77.29 N N N N
vg0235259448 G -> A LOC_Os02g57540-LOC_Os02g57550 intergenic_region ; MODIFIER silent_mutation Average:47.832; most accessible tissue: Minghui63 root, score: 77.29 N N N N
vg0235259448 G -> DEL N N silent_mutation Average:47.832; most accessible tissue: Minghui63 root, score: 77.29 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0235259448 NA 2.45E-06 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235259448 3.62E-07 1.55E-38 mr1448 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235259448 NA 1.17E-63 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235259448 NA 5.77E-09 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235259448 NA 7.48E-07 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251