\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235259229:

Variant ID: vg0235259229 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 35259229
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTACGACCCCAGTCAAACCCCGGTGGTCCGGTGATATTGTTCTGTTCAAGCTCAATTAGCAACTAAACAATACTAACAAGTAGTAAATAGAAAATTAGC[A/T]
AGCACTTATTATACGACAGCCCGATATACGTATGAGATTTGAGCCCAGAAGGCTTTGTATTCCTGCTAAACAAGTCCACAAATTGCCTTGTTGTGCTGCT

Reverse complement sequence

AGCAGCACAACAAGGCAATTTGTGGACTTGTTTAGCAGGAATACAAAGCCTTCTGGGCTCAAATCTCATACGTATATCGGGCTGTCGTATAATAAGTGCT[T/A]
GCTAATTTTCTATTTACTACTTGTTAGTATTGTTTAGTTGCTAATTGAGCTTGAACAGAACAATATCACCGGACCACCGGGGTTTGACTGGGGTCGTAGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.00% 27.80% 0.11% 0.00% NA
All Indica  2759 98.80% 1.10% 0.07% 0.00% NA
All Japonica  1512 25.70% 74.10% 0.13% 0.00% NA
Aus  269 54.30% 45.40% 0.37% 0.00% NA
Indica I  595 97.60% 2.20% 0.17% 0.00% NA
Indica II  465 99.40% 0.40% 0.22% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.70% 0.00% 0.00% NA
Temperate Japonica  767 8.60% 91.40% 0.00% 0.00% NA
Tropical Japonica  504 44.20% 55.40% 0.40% 0.00% NA
Japonica Intermediate  241 41.50% 58.50% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 61.10% 38.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0235259229 A -> T LOC_Os02g57540.1 upstream_gene_variant ; 994.0bp to feature; MODIFIER silent_mutation Average:59.833; most accessible tissue: Minghui63 root, score: 82.667 N N N N
vg0235259229 A -> T LOC_Os02g57530.1 downstream_gene_variant ; 3186.0bp to feature; MODIFIER silent_mutation Average:59.833; most accessible tissue: Minghui63 root, score: 82.667 N N N N
vg0235259229 A -> T LOC_Os02g57550.1 downstream_gene_variant ; 2029.0bp to feature; MODIFIER silent_mutation Average:59.833; most accessible tissue: Minghui63 root, score: 82.667 N N N N
vg0235259229 A -> T LOC_Os02g57560.1 downstream_gene_variant ; 3937.0bp to feature; MODIFIER silent_mutation Average:59.833; most accessible tissue: Minghui63 root, score: 82.667 N N N N
vg0235259229 A -> T LOC_Os02g57530.2 downstream_gene_variant ; 3186.0bp to feature; MODIFIER silent_mutation Average:59.833; most accessible tissue: Minghui63 root, score: 82.667 N N N N
vg0235259229 A -> T LOC_Os02g57530.3 downstream_gene_variant ; 3186.0bp to feature; MODIFIER silent_mutation Average:59.833; most accessible tissue: Minghui63 root, score: 82.667 N N N N
vg0235259229 A -> T LOC_Os02g57530.4 downstream_gene_variant ; 3186.0bp to feature; MODIFIER silent_mutation Average:59.833; most accessible tissue: Minghui63 root, score: 82.667 N N N N
vg0235259229 A -> T LOC_Os02g57540-LOC_Os02g57550 intergenic_region ; MODIFIER silent_mutation Average:59.833; most accessible tissue: Minghui63 root, score: 82.667 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0235259229 6.89E-06 NA mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235259229 1.85E-07 1.74E-07 mr1188 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235259229 7.54E-06 2.29E-36 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235259229 6.34E-06 2.26E-64 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235259229 3.17E-06 1.77E-09 mr1125_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235259229 NA 6.27E-07 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251