\
| Variant ID: vg0235259229 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 35259229 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCTACGACCCCAGTCAAACCCCGGTGGTCCGGTGATATTGTTCTGTTCAAGCTCAATTAGCAACTAAACAATACTAACAAGTAGTAAATAGAAAATTAGC[A/T]
AGCACTTATTATACGACAGCCCGATATACGTATGAGATTTGAGCCCAGAAGGCTTTGTATTCCTGCTAAACAAGTCCACAAATTGCCTTGTTGTGCTGCT
AGCAGCACAACAAGGCAATTTGTGGACTTGTTTAGCAGGAATACAAAGCCTTCTGGGCTCAAATCTCATACGTATATCGGGCTGTCGTATAATAAGTGCT[T/A]
GCTAATTTTCTATTTACTACTTGTTAGTATTGTTTAGTTGCTAATTGAGCTTGAACAGAACAATATCACCGGACCACCGGGGTTTGACTGGGGTCGTAGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.00% | 27.80% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 98.80% | 1.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 25.70% | 74.10% | 0.13% | 0.00% | NA |
| Aus | 269 | 54.30% | 45.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 97.60% | 2.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 8.60% | 91.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 44.20% | 55.40% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 41.50% | 58.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 38.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0235259229 | A -> T | LOC_Os02g57540.1 | upstream_gene_variant ; 994.0bp to feature; MODIFIER | silent_mutation | Average:59.833; most accessible tissue: Minghui63 root, score: 82.667 | N | N | N | N |
| vg0235259229 | A -> T | LOC_Os02g57530.1 | downstream_gene_variant ; 3186.0bp to feature; MODIFIER | silent_mutation | Average:59.833; most accessible tissue: Minghui63 root, score: 82.667 | N | N | N | N |
| vg0235259229 | A -> T | LOC_Os02g57550.1 | downstream_gene_variant ; 2029.0bp to feature; MODIFIER | silent_mutation | Average:59.833; most accessible tissue: Minghui63 root, score: 82.667 | N | N | N | N |
| vg0235259229 | A -> T | LOC_Os02g57560.1 | downstream_gene_variant ; 3937.0bp to feature; MODIFIER | silent_mutation | Average:59.833; most accessible tissue: Minghui63 root, score: 82.667 | N | N | N | N |
| vg0235259229 | A -> T | LOC_Os02g57530.2 | downstream_gene_variant ; 3186.0bp to feature; MODIFIER | silent_mutation | Average:59.833; most accessible tissue: Minghui63 root, score: 82.667 | N | N | N | N |
| vg0235259229 | A -> T | LOC_Os02g57530.3 | downstream_gene_variant ; 3186.0bp to feature; MODIFIER | silent_mutation | Average:59.833; most accessible tissue: Minghui63 root, score: 82.667 | N | N | N | N |
| vg0235259229 | A -> T | LOC_Os02g57530.4 | downstream_gene_variant ; 3186.0bp to feature; MODIFIER | silent_mutation | Average:59.833; most accessible tissue: Minghui63 root, score: 82.667 | N | N | N | N |
| vg0235259229 | A -> T | LOC_Os02g57540-LOC_Os02g57550 | intergenic_region ; MODIFIER | silent_mutation | Average:59.833; most accessible tissue: Minghui63 root, score: 82.667 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0235259229 | 6.89E-06 | NA | mr1188 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235259229 | 1.85E-07 | 1.74E-07 | mr1188 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235259229 | 7.54E-06 | 2.29E-36 | mr1448 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235259229 | 6.34E-06 | 2.26E-64 | mr1125_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235259229 | 3.17E-06 | 1.77E-09 | mr1125_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235259229 | NA | 6.27E-07 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |