Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235259229:

Variant ID: vg0235259229 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 35259229
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCTACGACCCCAGTCAAACCCCGGTGGTCCGGTGATATTGTTCTGTTCAAGCTCAATTAGCAACTAAACAATACTAACAAGTAGTAAATAGAAAATTAGC[A/T]
AGCACTTATTATACGACAGCCCGATATACGTATGAGATTTGAGCCCAGAAGGCTTTGTATTCCTGCTAAACAAGTCCACAAATTGCCTTGTTGTGCTGCT

Reverse complement sequence

AGCAGCACAACAAGGCAATTTGTGGACTTGTTTAGCAGGAATACAAAGCCTTCTGGGCTCAAATCTCATACGTATATCGGGCTGTCGTATAATAAGTGCT[T/A]
GCTAATTTTCTATTTACTACTTGTTAGTATTGTTTAGTTGCTAATTGAGCTTGAACAGAACAATATCACCGGACCACCGGGGTTTGACTGGGGTCGTAGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.00%	27.80%	0.11%	0.00%	NA
All Indica	2759	98.80%	1.10%	0.07%	0.00%	NA
All Japonica	1512	25.70%	74.10%	0.13%	0.00%	NA
Aus	269	54.30%	45.40%	0.37%	0.00%	NA
Indica I	595	97.60%	2.20%	0.17%	0.00%	NA
Indica II	465	99.40%	0.40%	0.22%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	98.30%	1.70%	0.00%	0.00%	NA
Temperate Japonica	767	8.60%	91.40%	0.00%	0.00%	NA
Tropical Japonica	504	44.20%	55.40%	0.40%	0.00%	NA
Japonica Intermediate	241	41.50%	58.50%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	61.10%	38.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0235259229	A -> T	LOC_Os02g57540.1	upstream_gene_variant ; 994.0bp to feature; MODIFIER	silent_mutation	Average:59.833; most accessible tissue: Minghui63 root, score: 82.667	N	N	N	N
vg0235259229	A -> T	LOC_Os02g57530.1	downstream_gene_variant ; 3186.0bp to feature; MODIFIER	silent_mutation	Average:59.833; most accessible tissue: Minghui63 root, score: 82.667	N	N	N	N
vg0235259229	A -> T	LOC_Os02g57550.1	downstream_gene_variant ; 2029.0bp to feature; MODIFIER	silent_mutation	Average:59.833; most accessible tissue: Minghui63 root, score: 82.667	N	N	N	N
vg0235259229	A -> T	LOC_Os02g57560.1	downstream_gene_variant ; 3937.0bp to feature; MODIFIER	silent_mutation	Average:59.833; most accessible tissue: Minghui63 root, score: 82.667	N	N	N	N
vg0235259229	A -> T	LOC_Os02g57530.2	downstream_gene_variant ; 3186.0bp to feature; MODIFIER	silent_mutation	Average:59.833; most accessible tissue: Minghui63 root, score: 82.667	N	N	N	N
vg0235259229	A -> T	LOC_Os02g57530.3	downstream_gene_variant ; 3186.0bp to feature; MODIFIER	silent_mutation	Average:59.833; most accessible tissue: Minghui63 root, score: 82.667	N	N	N	N
vg0235259229	A -> T	LOC_Os02g57530.4	downstream_gene_variant ; 3186.0bp to feature; MODIFIER	silent_mutation	Average:59.833; most accessible tissue: Minghui63 root, score: 82.667	N	N	N	N
vg0235259229	A -> T	LOC_Os02g57540-LOC_Os02g57550	intergenic_region ; MODIFIER	silent_mutation	Average:59.833; most accessible tissue: Minghui63 root, score: 82.667	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0235259229	6.89E-06	NA	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235259229	1.85E-07	1.74E-07	mr1188	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235259229	7.54E-06	2.29E-36	mr1448	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235259229	6.34E-06	2.26E-64	mr1125_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235259229	3.17E-06	1.77E-09	mr1125_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235259229	NA	6.27E-07	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251