Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0235229570:

Variant ID: vg0235229570 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 35229570
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGACTATTCGTTTTATTTAATTTATTTTATGAATAGTATTTTATTGTTATTAGATAAAAAATGAATAGTACTTTATGCGTAATTTATATTTTTAATTTTT[T/C]
TAAATAAGATGGACGGTTAAATGTTATATACCGAAACCCACAGGGAGCCTGAGAGGGAGCAATACATTTTGGATTTGGTTCAGGTGCAGTCCCTAGTGTG

Reverse complement sequence

CACACTAGGGACTGCACCTGAACCAAATCCAAAATGTATTGCTCCCTCTCAGGCTCCCTGTGGGTTTCGGTATATAACATTTAACCGTCCATCTTATTTA[A/G]
AAAAATTAAAAATATAAATTACGCATAAAGTACTATTCATTTTTTATCTAATAACAATAAAATACTATTCATAAAATAAATTAAATAAAACGAATAGTCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.70%	25.20%	0.17%	0.00%	NA
All Indica	2759	98.90%	1.00%	0.11%	0.00%	NA
All Japonica	1512	27.00%	72.80%	0.26%	0.00%	NA
Aus	269	88.80%	11.20%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	99.40%	0.40%	0.22%	0.00%	NA
Indica III	913	99.30%	0.70%	0.00%	0.00%	NA
Indica Intermediate	786	97.60%	2.20%	0.25%	0.00%	NA
Temperate Japonica	767	8.70%	91.30%	0.00%	0.00%	NA
Tropical Japonica	504	47.60%	51.80%	0.60%	0.00%	NA
Japonica Intermediate	241	41.90%	57.70%	0.41%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	66.70%	32.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0235229570	T -> C	LOC_Os02g57490.1	upstream_gene_variant ; 961.0bp to feature; MODIFIER	silent_mutation	Average:58.727; most accessible tissue: Callus, score: 92.639	N	N	N	N
vg0235229570	T -> C	LOC_Os02g57510.1	upstream_gene_variant ; 4556.0bp to feature; MODIFIER	silent_mutation	Average:58.727; most accessible tissue: Callus, score: 92.639	N	N	N	N
vg0235229570	T -> C	LOC_Os02g57510.2	upstream_gene_variant ; 4556.0bp to feature; MODIFIER	silent_mutation	Average:58.727; most accessible tissue: Callus, score: 92.639	N	N	N	N
vg0235229570	T -> C	LOC_Os02g57510.4	upstream_gene_variant ; 4556.0bp to feature; MODIFIER	silent_mutation	Average:58.727; most accessible tissue: Callus, score: 92.639	N	N	N	N
vg0235229570	T -> C	LOC_Os02g57510.3	upstream_gene_variant ; 4577.0bp to feature; MODIFIER	silent_mutation	Average:58.727; most accessible tissue: Callus, score: 92.639	N	N	N	N
vg0235229570	T -> C	LOC_Os02g57500.1	downstream_gene_variant ; 1132.0bp to feature; MODIFIER	silent_mutation	Average:58.727; most accessible tissue: Callus, score: 92.639	N	N	N	N
vg0235229570	T -> C	LOC_Os02g57490-LOC_Os02g57500	intergenic_region ; MODIFIER	silent_mutation	Average:58.727; most accessible tissue: Callus, score: 92.639	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0235229570	2.32E-08	5.01E-13	mr1188	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235229570	NA	6.66E-34	mr1448	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235229570	NA	8.81E-06	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235229570	NA	1.06E-11	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235229570	NA	9.65E-14	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235229570	NA	1.11E-11	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235229570	NA	6.48E-08	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235229570	NA	2.10E-12	mr1188_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251