| Variant ID: vg0235229570 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 35229570 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGACTATTCGTTTTATTTAATTTATTTTATGAATAGTATTTTATTGTTATTAGATAAAAAATGAATAGTACTTTATGCGTAATTTATATTTTTAATTTTT[T/C]
TAAATAAGATGGACGGTTAAATGTTATATACCGAAACCCACAGGGAGCCTGAGAGGGAGCAATACATTTTGGATTTGGTTCAGGTGCAGTCCCTAGTGTG
CACACTAGGGACTGCACCTGAACCAAATCCAAAATGTATTGCTCCCTCTCAGGCTCCCTGTGGGTTTCGGTATATAACATTTAACCGTCCATCTTATTTA[A/G]
AAAAATTAAAAATATAAATTACGCATAAAGTACTATTCATTTTTTATCTAATAACAATAAAATACTATTCATAAAATAAATTAAATAAAACGAATAGTCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.70% | 25.20% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 1.00% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 27.00% | 72.80% | 0.26% | 0.00% | NA |
| Aus | 269 | 88.80% | 11.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.60% | 2.20% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 8.70% | 91.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 47.60% | 51.80% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 41.90% | 57.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 32.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0235229570 | T -> C | LOC_Os02g57490.1 | upstream_gene_variant ; 961.0bp to feature; MODIFIER | silent_mutation | Average:58.727; most accessible tissue: Callus, score: 92.639 | N | N | N | N |
| vg0235229570 | T -> C | LOC_Os02g57510.1 | upstream_gene_variant ; 4556.0bp to feature; MODIFIER | silent_mutation | Average:58.727; most accessible tissue: Callus, score: 92.639 | N | N | N | N |
| vg0235229570 | T -> C | LOC_Os02g57510.2 | upstream_gene_variant ; 4556.0bp to feature; MODIFIER | silent_mutation | Average:58.727; most accessible tissue: Callus, score: 92.639 | N | N | N | N |
| vg0235229570 | T -> C | LOC_Os02g57510.4 | upstream_gene_variant ; 4556.0bp to feature; MODIFIER | silent_mutation | Average:58.727; most accessible tissue: Callus, score: 92.639 | N | N | N | N |
| vg0235229570 | T -> C | LOC_Os02g57510.3 | upstream_gene_variant ; 4577.0bp to feature; MODIFIER | silent_mutation | Average:58.727; most accessible tissue: Callus, score: 92.639 | N | N | N | N |
| vg0235229570 | T -> C | LOC_Os02g57500.1 | downstream_gene_variant ; 1132.0bp to feature; MODIFIER | silent_mutation | Average:58.727; most accessible tissue: Callus, score: 92.639 | N | N | N | N |
| vg0235229570 | T -> C | LOC_Os02g57490-LOC_Os02g57500 | intergenic_region ; MODIFIER | silent_mutation | Average:58.727; most accessible tissue: Callus, score: 92.639 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0235229570 | 2.32E-08 | 5.01E-13 | mr1188 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235229570 | NA | 6.66E-34 | mr1448 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235229570 | NA | 8.81E-06 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235229570 | NA | 1.06E-11 | mr1636 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235229570 | NA | 9.65E-14 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235229570 | NA | 1.11E-11 | mr1667 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235229570 | NA | 6.48E-08 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235229570 | NA | 2.10E-12 | mr1188_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |