\
| Variant ID: vg0235196559 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 35196559 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.03, others allele: 0.00, population size: 227. )
GATCTTGTTGAATCATGACAGATGTTGGAGACTTGGAGTGTACCCCACTATCCGTAATCTCTGCAGTACCTTCGCATCATGCTGTTTCTGTAATTCTGTT[A/G]
GCACTAATTAAACTAGAGATTCAGAGCGCAGTTGCTTATGATTGATTTAGGTCATGTTCTTTTTATATTATCTATCAAATTATTGTCGTAGATTATTTGT
ACAAATAATCTACGACAATAATTTGATAGATAATATAAAAAGAACATGACCTAAATCAATCATAAGCAACTGCGCTCTGAATCTCTAGTTTAATTAGTGC[T/C]
AACAGAATTACAGAAACAGCATGATGCGAAGGTACTGCAGAGATTACGGATAGTGGGGTACACTCCAAGTCTCCAACATCTGTCATGATTCAACAAGATC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.10% | 8.80% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 85.40% | 14.50% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 74.80% | 25.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 85.80% | 14.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 4.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0235196559 | A -> G | LOC_Os02g57420.1 | upstream_gene_variant ; 2248.0bp to feature; MODIFIER | silent_mutation | Average:68.381; most accessible tissue: Callus, score: 88.389 | N | N | N | N |
| vg0235196559 | A -> G | LOC_Os02g57430.1 | downstream_gene_variant ; 2856.0bp to feature; MODIFIER | silent_mutation | Average:68.381; most accessible tissue: Callus, score: 88.389 | N | N | N | N |
| vg0235196559 | A -> G | LOC_Os02g57420-LOC_Os02g57430 | intergenic_region ; MODIFIER | silent_mutation | Average:68.381; most accessible tissue: Callus, score: 88.389 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0235196559 | 4.28E-06 | 4.28E-06 | mr1151_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235196559 | NA | 4.44E-06 | mr1194_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235196559 | NA | 2.44E-06 | mr1215_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235196559 | NA | 1.40E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235196559 | NA | 3.95E-06 | mr1713_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235196559 | NA | 8.43E-06 | mr1800_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235196559 | NA | 6.09E-06 | mr1844_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |