\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235196559:

Variant ID: vg0235196559 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 35196559
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.03, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


GATCTTGTTGAATCATGACAGATGTTGGAGACTTGGAGTGTACCCCACTATCCGTAATCTCTGCAGTACCTTCGCATCATGCTGTTTCTGTAATTCTGTT[A/G]
GCACTAATTAAACTAGAGATTCAGAGCGCAGTTGCTTATGATTGATTTAGGTCATGTTCTTTTTATATTATCTATCAAATTATTGTCGTAGATTATTTGT

Reverse complement sequence

ACAAATAATCTACGACAATAATTTGATAGATAATATAAAAAGAACATGACCTAAATCAATCATAAGCAACTGCGCTCTGAATCTCTAGTTTAATTAGTGC[T/C]
AACAGAATTACAGAAACAGCATGATGCGAAGGTACTGCAGAGATTACGGATAGTGGGGTACACTCCAAGTCTCCAACATCTGTCATGATTCAACAAGATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.10% 8.80% 0.06% 0.00% NA
All Indica  2759 85.40% 14.50% 0.07% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 97.00% 3.00% 0.00% 0.00% NA
Indica I  595 93.40% 6.60% 0.00% 0.00% NA
Indica II  465 95.50% 4.50% 0.00% 0.00% NA
Indica III  913 74.80% 25.10% 0.11% 0.00% NA
Indica Intermediate  786 85.80% 14.10% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 4.20% 1.04% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0235196559 A -> G LOC_Os02g57420.1 upstream_gene_variant ; 2248.0bp to feature; MODIFIER silent_mutation Average:68.381; most accessible tissue: Callus, score: 88.389 N N N N
vg0235196559 A -> G LOC_Os02g57430.1 downstream_gene_variant ; 2856.0bp to feature; MODIFIER silent_mutation Average:68.381; most accessible tissue: Callus, score: 88.389 N N N N
vg0235196559 A -> G LOC_Os02g57420-LOC_Os02g57430 intergenic_region ; MODIFIER silent_mutation Average:68.381; most accessible tissue: Callus, score: 88.389 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0235196559 4.28E-06 4.28E-06 mr1151_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235196559 NA 4.44E-06 mr1194_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235196559 NA 2.44E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235196559 NA 1.40E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235196559 NA 3.95E-06 mr1713_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235196559 NA 8.43E-06 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235196559 NA 6.09E-06 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251