\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235187821:

Variant ID: vg0235187821 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 35187821
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, A: 0.01, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


GAAATATTTTACTGTATTGCTTATTATATCGTTTGGTTAAACTATGCCAAACAATAATTGTTGTTGCATCCCGGCCATGCATGATGGGCTTGAATTAAAA[C/A]
CATTATCCTCTCTACCATTAGTCATATCTTCCCGTCGTCATCAACAGGTAGATTAATTGGATCTCTAAACCTTCTGAATGTTCATCTCCACACCTAAATG

Reverse complement sequence

CATTTAGGTGTGGAGATGAACATTCAGAAGGTTTAGAGATCCAATTAATCTACCTGTTGATGACGACGGGAAGATATGACTAATGGTAGAGAGGATAATG[G/T]
TTTTAATTCAAGCCCATCATGCATGGCCGGGATGCAACAACAATTATTGTTTGGCATAGTTTAACCAAACGATATAATAAGCAATACAGTAAAATATTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.00% 47.70% 0.28% 0.00% NA
All Indica  2759 34.90% 64.80% 0.36% 0.00% NA
All Japonica  1512 74.70% 25.30% 0.00% 0.00% NA
Aus  269 84.40% 14.50% 1.12% 0.00% NA
Indica I  595 30.10% 69.40% 0.50% 0.00% NA
Indica II  465 14.60% 85.20% 0.22% 0.00% NA
Indica III  913 48.60% 51.00% 0.33% 0.00% NA
Indica Intermediate  786 34.50% 65.10% 0.38% 0.00% NA
Temperate Japonica  767 91.70% 8.30% 0.00% 0.00% NA
Tropical Japonica  504 56.50% 43.50% 0.00% 0.00% NA
Japonica Intermediate  241 58.90% 41.10% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 57.80% 42.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0235187821 C -> A LOC_Os02g57410.1 upstream_gene_variant ; 3663.0bp to feature; MODIFIER silent_mutation Average:82.465; most accessible tissue: Minghui63 root, score: 95.261 N N N N
vg0235187821 C -> A LOC_Os02g57410.3 upstream_gene_variant ; 3663.0bp to feature; MODIFIER silent_mutation Average:82.465; most accessible tissue: Minghui63 root, score: 95.261 N N N N
vg0235187821 C -> A LOC_Os02g57410.5 upstream_gene_variant ; 3663.0bp to feature; MODIFIER silent_mutation Average:82.465; most accessible tissue: Minghui63 root, score: 95.261 N N N N
vg0235187821 C -> A LOC_Os02g57410.6 upstream_gene_variant ; 3663.0bp to feature; MODIFIER silent_mutation Average:82.465; most accessible tissue: Minghui63 root, score: 95.261 N N N N
vg0235187821 C -> A LOC_Os02g57410.7 upstream_gene_variant ; 3663.0bp to feature; MODIFIER silent_mutation Average:82.465; most accessible tissue: Minghui63 root, score: 95.261 N N N N
vg0235187821 C -> A LOC_Os02g57410.8 upstream_gene_variant ; 3663.0bp to feature; MODIFIER silent_mutation Average:82.465; most accessible tissue: Minghui63 root, score: 95.261 N N N N
vg0235187821 C -> A LOC_Os02g57410.9 upstream_gene_variant ; 3663.0bp to feature; MODIFIER silent_mutation Average:82.465; most accessible tissue: Minghui63 root, score: 95.261 N N N N
vg0235187821 C -> A LOC_Os02g57410.10 upstream_gene_variant ; 3663.0bp to feature; MODIFIER silent_mutation Average:82.465; most accessible tissue: Minghui63 root, score: 95.261 N N N N
vg0235187821 C -> A LOC_Os02g57410.4 upstream_gene_variant ; 3663.0bp to feature; MODIFIER silent_mutation Average:82.465; most accessible tissue: Minghui63 root, score: 95.261 N N N N
vg0235187821 C -> A LOC_Os02g57410.2 upstream_gene_variant ; 3663.0bp to feature; MODIFIER silent_mutation Average:82.465; most accessible tissue: Minghui63 root, score: 95.261 N N N N
vg0235187821 C -> A LOC_Os02g57420.1 downstream_gene_variant ; 2572.0bp to feature; MODIFIER silent_mutation Average:82.465; most accessible tissue: Minghui63 root, score: 95.261 N N N N
vg0235187821 C -> A LOC_Os02g57410-LOC_Os02g57420 intergenic_region ; MODIFIER silent_mutation Average:82.465; most accessible tissue: Minghui63 root, score: 95.261 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0235187821 C A 0.22 -0.05 -0.07 -0.02 -0.05 -0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0235187821 1.83E-06 NA mr1188 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235187821 NA 2.52E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235187821 5.63E-07 NA mr1861_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251