\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235186964:

Variant ID: vg0235186964 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 35186964
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


TACTCCTACTACCGCTATATGAAGTGGTATATATTTATTATTTTATTTTAATGGTGACAGAGAGGATACACGTGGACACATTACTATACACGTAAACCAC[A/C]
AAGATTTACCATTTCCATCCTATAAAAAACCTAATACTTGTGTGTCCAGGTTCAATGCTAGAAATAATTTTTTTAAGGGCAGAGAAGTATGACTATCGTC

Reverse complement sequence

GACGATAGTCATACTTCTCTGCCCTTAAAAAAATTATTTCTAGCATTGAACCTGGACACACAAGTATTAGGTTTTTTATAGGATGGAAATGGTAAATCTT[T/G]
GTGGTTTACGTGTATAGTAATGTGTCCACGTGTATCCTCTCTGTCACCATTAAAATAAAATAATAAATATATACCACTTCATATAGCGGTAGTAGGAGTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.30% 41.30% 0.40% 0.00% NA
All Indica  2759 45.50% 53.80% 0.69% 0.00% NA
All Japonica  1512 74.70% 25.30% 0.00% 0.00% NA
Aus  269 85.10% 14.90% 0.00% 0.00% NA
Indica I  595 42.90% 56.10% 1.01% 0.00% NA
Indica II  465 23.70% 75.50% 0.86% 0.00% NA
Indica III  913 54.50% 45.00% 0.44% 0.00% NA
Indica Intermediate  786 49.90% 49.50% 0.64% 0.00% NA
Temperate Japonica  767 91.80% 8.20% 0.00% 0.00% NA
Tropical Japonica  504 56.50% 43.50% 0.00% 0.00% NA
Japonica Intermediate  241 58.50% 41.50% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 61.10% 38.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0235186964 A -> C LOC_Os02g57410.1 upstream_gene_variant ; 2806.0bp to feature; MODIFIER silent_mutation Average:97.141; most accessible tissue: Minghui63 flag leaf, score: 99.2 N N N N
vg0235186964 A -> C LOC_Os02g57410.3 upstream_gene_variant ; 2806.0bp to feature; MODIFIER silent_mutation Average:97.141; most accessible tissue: Minghui63 flag leaf, score: 99.2 N N N N
vg0235186964 A -> C LOC_Os02g57410.5 upstream_gene_variant ; 2806.0bp to feature; MODIFIER silent_mutation Average:97.141; most accessible tissue: Minghui63 flag leaf, score: 99.2 N N N N
vg0235186964 A -> C LOC_Os02g57410.6 upstream_gene_variant ; 2806.0bp to feature; MODIFIER silent_mutation Average:97.141; most accessible tissue: Minghui63 flag leaf, score: 99.2 N N N N
vg0235186964 A -> C LOC_Os02g57410.7 upstream_gene_variant ; 2806.0bp to feature; MODIFIER silent_mutation Average:97.141; most accessible tissue: Minghui63 flag leaf, score: 99.2 N N N N
vg0235186964 A -> C LOC_Os02g57410.8 upstream_gene_variant ; 2806.0bp to feature; MODIFIER silent_mutation Average:97.141; most accessible tissue: Minghui63 flag leaf, score: 99.2 N N N N
vg0235186964 A -> C LOC_Os02g57410.9 upstream_gene_variant ; 2806.0bp to feature; MODIFIER silent_mutation Average:97.141; most accessible tissue: Minghui63 flag leaf, score: 99.2 N N N N
vg0235186964 A -> C LOC_Os02g57410.10 upstream_gene_variant ; 2806.0bp to feature; MODIFIER silent_mutation Average:97.141; most accessible tissue: Minghui63 flag leaf, score: 99.2 N N N N
vg0235186964 A -> C LOC_Os02g57410.4 upstream_gene_variant ; 2806.0bp to feature; MODIFIER silent_mutation Average:97.141; most accessible tissue: Minghui63 flag leaf, score: 99.2 N N N N
vg0235186964 A -> C LOC_Os02g57410.2 upstream_gene_variant ; 2806.0bp to feature; MODIFIER silent_mutation Average:97.141; most accessible tissue: Minghui63 flag leaf, score: 99.2 N N N N
vg0235186964 A -> C LOC_Os02g57420.1 downstream_gene_variant ; 3429.0bp to feature; MODIFIER silent_mutation Average:97.141; most accessible tissue: Minghui63 flag leaf, score: 99.2 N N N N
vg0235186964 A -> C LOC_Os02g57410-LOC_Os02g57420 intergenic_region ; MODIFIER silent_mutation Average:97.141; most accessible tissue: Minghui63 flag leaf, score: 99.2 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0235186964 A C 0.01 0.0 -0.01 0.0 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0235186964 9.33E-06 NA mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235186964 NA 2.12E-07 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235186964 2.68E-06 1.58E-12 mr1188_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235186964 NA 8.94E-09 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235186964 NA 9.43E-08 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251