Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0235128728:

Variant ID: vg0235128728 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 35128728
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 43. )

Flanking Sequence (100 bp) in Reference Genome:

ATGTGTGACTTATGTGTTTTAATTTTTCTTAAATAAATTTCAAATAAGACGGACGATCAAAGTTGGGCACGGATATTCATGCTTGCACTTAAAATGAGAC[A/G]
AAGGGAGTACTACGTACGAATAGTAATTTTGTTTAGGCCCTGTTTAGATCTCACCCTAAAATTTTTCACCCTGTCACATCGAACGTTTGAACACCTACAT

Reverse complement sequence

ATGTAGGTGTTCAAACGTTCGATGTGACAGGGTGAAAAATTTTAGGGTGAGATCTAAACAGGGCCTAAACAAAATTACTATTCGTACGTAGTACTCCCTT[T/C]
GTCTCATTTTAAGTGCAAGCATGAATATCCGTGCCCAACTTTGATCGTCCGTCTTATTTGAAATTTATTTAAGAAAAATTAAAACACATAAGTCACACAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.50%	33.20%	0.19%	0.08%	NA
All Indica	2759	88.10%	11.60%	0.22%	0.07%	NA
All Japonica	1512	26.40%	73.50%	0.07%	0.07%	NA
Aus	269	65.10%	34.90%	0.00%	0.00%	NA
Indica I	595	96.10%	3.40%	0.50%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	82.60%	17.00%	0.22%	0.22%	NA
Indica Intermediate	786	82.10%	17.80%	0.13%	0.00%	NA
Temperate Japonica	767	9.10%	90.70%	0.13%	0.00%	NA
Tropical Japonica	504	43.10%	56.70%	0.00%	0.20%	NA
Japonica Intermediate	241	46.50%	53.50%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	56.70%	40.00%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0235128728	A -> G	LOC_Os02g57350.1	upstream_gene_variant ; 1946.0bp to feature; MODIFIER	silent_mutation	Average:41.853; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0235128728	A -> G	LOC_Os02g57360.1	upstream_gene_variant ; 4384.0bp to feature; MODIFIER	silent_mutation	Average:41.853; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0235128728	A -> G	LOC_Os02g57340.1	downstream_gene_variant ; 1912.0bp to feature; MODIFIER	silent_mutation	Average:41.853; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0235128728	A -> G	LOC_Os02g57340-LOC_Os02g57350	intergenic_region ; MODIFIER	silent_mutation	Average:41.853; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0235128728	A -> DEL	N	N	silent_mutation	Average:41.853; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0235128728	NA	1.37E-06	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728	NA	5.12E-06	mr1200	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728	NA	2.04E-06	mr1229	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728	1.47E-06	1.47E-06	mr1275	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728	3.63E-06	3.63E-06	mr1393	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728	NA	5.60E-06	mr1427	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728	NA	2.10E-07	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728	NA	2.87E-06	mr1509	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728	NA	4.11E-06	mr1515	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728	2.83E-07	NA	mr1558	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728	5.34E-06	6.13E-08	mr1574	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728	NA	9.81E-06	mr1755	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728	NA	4.20E-06	mr1765	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728	NA	6.14E-09	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728	NA	6.21E-08	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728	NA	2.21E-06	mr1981	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728	NA	8.16E-07	mr1982	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251