\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235128728:

Variant ID: vg0235128728 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 35128728
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 43. )

Flanking Sequence (100 bp) in Reference Genome:


ATGTGTGACTTATGTGTTTTAATTTTTCTTAAATAAATTTCAAATAAGACGGACGATCAAAGTTGGGCACGGATATTCATGCTTGCACTTAAAATGAGAC[A/G]
AAGGGAGTACTACGTACGAATAGTAATTTTGTTTAGGCCCTGTTTAGATCTCACCCTAAAATTTTTCACCCTGTCACATCGAACGTTTGAACACCTACAT

Reverse complement sequence

ATGTAGGTGTTCAAACGTTCGATGTGACAGGGTGAAAAATTTTAGGGTGAGATCTAAACAGGGCCTAAACAAAATTACTATTCGTACGTAGTACTCCCTT[T/C]
GTCTCATTTTAAGTGCAAGCATGAATATCCGTGCCCAACTTTGATCGTCCGTCTTATTTGAAATTTATTTAAGAAAAATTAAAACACATAAGTCACACAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.50% 33.20% 0.19% 0.08% NA
All Indica  2759 88.10% 11.60% 0.22% 0.07% NA
All Japonica  1512 26.40% 73.50% 0.07% 0.07% NA
Aus  269 65.10% 34.90% 0.00% 0.00% NA
Indica I  595 96.10% 3.40% 0.50% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 82.60% 17.00% 0.22% 0.22% NA
Indica Intermediate  786 82.10% 17.80% 0.13% 0.00% NA
Temperate Japonica  767 9.10% 90.70% 0.13% 0.00% NA
Tropical Japonica  504 43.10% 56.70% 0.00% 0.20% NA
Japonica Intermediate  241 46.50% 53.50% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 56.70% 40.00% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0235128728 A -> G LOC_Os02g57350.1 upstream_gene_variant ; 1946.0bp to feature; MODIFIER silent_mutation Average:41.853; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0235128728 A -> G LOC_Os02g57360.1 upstream_gene_variant ; 4384.0bp to feature; MODIFIER silent_mutation Average:41.853; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0235128728 A -> G LOC_Os02g57340.1 downstream_gene_variant ; 1912.0bp to feature; MODIFIER silent_mutation Average:41.853; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0235128728 A -> G LOC_Os02g57340-LOC_Os02g57350 intergenic_region ; MODIFIER silent_mutation Average:41.853; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0235128728 A -> DEL N N silent_mutation Average:41.853; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0235128728 NA 1.37E-06 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728 NA 5.12E-06 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728 NA 2.04E-06 mr1229 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728 1.47E-06 1.47E-06 mr1275 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728 3.63E-06 3.63E-06 mr1393 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728 NA 5.60E-06 mr1427 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728 NA 2.10E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728 NA 2.87E-06 mr1509 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728 NA 4.11E-06 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728 2.83E-07 NA mr1558 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728 5.34E-06 6.13E-08 mr1574 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728 NA 9.81E-06 mr1755 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728 NA 4.20E-06 mr1765 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728 NA 6.14E-09 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728 NA 6.21E-08 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728 NA 2.21E-06 mr1981 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128728 NA 8.16E-07 mr1982 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251