\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235128703:

Variant ID: vg0235128703 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 35128703
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


GATGATAAAATATGAACAGCACTTTATGTGTGACTTATGTGTTTTAATTTTTCTTAAATAAATTTCAAATAAGACGGACGATCAAAGTTGGGCACGGATA[T/C]
TCATGCTTGCACTTAAAATGAGACAAAGGGAGTACTACGTACGAATAGTAATTTTGTTTAGGCCCTGTTTAGATCTCACCCTAAAATTTTTCACCCTGTC

Reverse complement sequence

GACAGGGTGAAAAATTTTAGGGTGAGATCTAAACAGGGCCTAAACAAAATTACTATTCGTACGTAGTACTCCCTTTGTCTCATTTTAAGTGCAAGCATGA[A/G]
TATCCGTGCCCAACTTTGATCGTCCGTCTTATTTGAAATTTATTTAAGAAAAATTAAAACACATAAGTCACACATAAAGTGCTGTTCATATTTTATCATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.10% 33.40% 2.41% 1.10% NA
All Indica  2759 82.60% 11.70% 4.02% 1.67% NA
All Japonica  1512 25.70% 73.90% 0.20% 0.20% NA
Aus  269 65.10% 34.90% 0.00% 0.00% NA
Indica I  595 90.10% 3.90% 4.03% 2.02% NA
Indica II  465 89.90% 1.50% 5.81% 2.80% NA
Indica III  913 80.30% 17.00% 2.08% 0.66% NA
Indica Intermediate  786 75.20% 17.70% 5.22% 1.91% NA
Temperate Japonica  767 8.60% 90.70% 0.39% 0.26% NA
Tropical Japonica  504 42.10% 57.70% 0.00% 0.20% NA
Japonica Intermediate  241 46.10% 53.90% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 57.80% 38.90% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0235128703 T -> DEL N N silent_mutation Average:44.363; most accessible tissue: Zhenshan97 root, score: 67.648 N N N N
vg0235128703 T -> C LOC_Os02g57350.1 upstream_gene_variant ; 1971.0bp to feature; MODIFIER silent_mutation Average:44.363; most accessible tissue: Zhenshan97 root, score: 67.648 N N N N
vg0235128703 T -> C LOC_Os02g57360.1 upstream_gene_variant ; 4409.0bp to feature; MODIFIER silent_mutation Average:44.363; most accessible tissue: Zhenshan97 root, score: 67.648 N N N N
vg0235128703 T -> C LOC_Os02g57340.1 downstream_gene_variant ; 1887.0bp to feature; MODIFIER silent_mutation Average:44.363; most accessible tissue: Zhenshan97 root, score: 67.648 N N N N
vg0235128703 T -> C LOC_Os02g57340-LOC_Os02g57350 intergenic_region ; MODIFIER silent_mutation Average:44.363; most accessible tissue: Zhenshan97 root, score: 67.648 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0235128703 NA 3.99E-09 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128703 NA 8.40E-08 mr1092_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128703 NA 1.10E-06 mr1097_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128703 NA 9.53E-07 mr1102_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128703 NA 4.54E-07 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128703 NA 1.39E-07 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128703 8.22E-06 5.21E-07 mr1223_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128703 NA 7.43E-06 mr1239_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128703 8.75E-06 6.10E-06 mr1407_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128703 NA 4.88E-06 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251