\
| Variant ID: vg0235128703 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 35128703 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, others allele: 0.00, population size: 45. )
GATGATAAAATATGAACAGCACTTTATGTGTGACTTATGTGTTTTAATTTTTCTTAAATAAATTTCAAATAAGACGGACGATCAAAGTTGGGCACGGATA[T/C]
TCATGCTTGCACTTAAAATGAGACAAAGGGAGTACTACGTACGAATAGTAATTTTGTTTAGGCCCTGTTTAGATCTCACCCTAAAATTTTTCACCCTGTC
GACAGGGTGAAAAATTTTAGGGTGAGATCTAAACAGGGCCTAAACAAAATTACTATTCGTACGTAGTACTCCCTTTGTCTCATTTTAAGTGCAAGCATGA[A/G]
TATCCGTGCCCAACTTTGATCGTCCGTCTTATTTGAAATTTATTTAAGAAAAATTAAAACACATAAGTCACACATAAAGTGCTGTTCATATTTTATCATC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.10% | 33.40% | 2.41% | 1.10% | NA |
| All Indica | 2759 | 82.60% | 11.70% | 4.02% | 1.67% | NA |
| All Japonica | 1512 | 25.70% | 73.90% | 0.20% | 0.20% | NA |
| Aus | 269 | 65.10% | 34.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.10% | 3.90% | 4.03% | 2.02% | NA |
| Indica II | 465 | 89.90% | 1.50% | 5.81% | 2.80% | NA |
| Indica III | 913 | 80.30% | 17.00% | 2.08% | 0.66% | NA |
| Indica Intermediate | 786 | 75.20% | 17.70% | 5.22% | 1.91% | NA |
| Temperate Japonica | 767 | 8.60% | 90.70% | 0.39% | 0.26% | NA |
| Tropical Japonica | 504 | 42.10% | 57.70% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 46.10% | 53.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 38.90% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0235128703 | T -> DEL | N | N | silent_mutation | Average:44.363; most accessible tissue: Zhenshan97 root, score: 67.648 | N | N | N | N |
| vg0235128703 | T -> C | LOC_Os02g57350.1 | upstream_gene_variant ; 1971.0bp to feature; MODIFIER | silent_mutation | Average:44.363; most accessible tissue: Zhenshan97 root, score: 67.648 | N | N | N | N |
| vg0235128703 | T -> C | LOC_Os02g57360.1 | upstream_gene_variant ; 4409.0bp to feature; MODIFIER | silent_mutation | Average:44.363; most accessible tissue: Zhenshan97 root, score: 67.648 | N | N | N | N |
| vg0235128703 | T -> C | LOC_Os02g57340.1 | downstream_gene_variant ; 1887.0bp to feature; MODIFIER | silent_mutation | Average:44.363; most accessible tissue: Zhenshan97 root, score: 67.648 | N | N | N | N |
| vg0235128703 | T -> C | LOC_Os02g57340-LOC_Os02g57350 | intergenic_region ; MODIFIER | silent_mutation | Average:44.363; most accessible tissue: Zhenshan97 root, score: 67.648 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0235128703 | NA | 3.99E-09 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235128703 | NA | 8.40E-08 | mr1092_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235128703 | NA | 1.10E-06 | mr1097_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235128703 | NA | 9.53E-07 | mr1102_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235128703 | NA | 4.54E-07 | mr1152_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235128703 | NA | 1.39E-07 | mr1154_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235128703 | 8.22E-06 | 5.21E-07 | mr1223_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235128703 | NA | 7.43E-06 | mr1239_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235128703 | 8.75E-06 | 6.10E-06 | mr1407_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235128703 | NA | 4.88E-06 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |