Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235128703:

Variant ID: vg0235128703 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 35128703
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:

GATGATAAAATATGAACAGCACTTTATGTGTGACTTATGTGTTTTAATTTTTCTTAAATAAATTTCAAATAAGACGGACGATCAAAGTTGGGCACGGATA[T/C]
TCATGCTTGCACTTAAAATGAGACAAAGGGAGTACTACGTACGAATAGTAATTTTGTTTAGGCCCTGTTTAGATCTCACCCTAAAATTTTTCACCCTGTC

Reverse complement sequence

GACAGGGTGAAAAATTTTAGGGTGAGATCTAAACAGGGCCTAAACAAAATTACTATTCGTACGTAGTACTCCCTTTGTCTCATTTTAAGTGCAAGCATGA[A/G]
TATCCGTGCCCAACTTTGATCGTCCGTCTTATTTGAAATTTATTTAAGAAAAATTAAAACACATAAGTCACACATAAAGTGCTGTTCATATTTTATCATC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.10%	33.40%	2.41%	1.10%	NA
All Indica	2759	82.60%	11.70%	4.02%	1.67%	NA
All Japonica	1512	25.70%	73.90%	0.20%	0.20%	NA
Aus	269	65.10%	34.90%	0.00%	0.00%	NA
Indica I	595	90.10%	3.90%	4.03%	2.02%	NA
Indica II	465	89.90%	1.50%	5.81%	2.80%	NA
Indica III	913	80.30%	17.00%	2.08%	0.66%	NA
Indica Intermediate	786	75.20%	17.70%	5.22%	1.91%	NA
Temperate Japonica	767	8.60%	90.70%	0.39%	0.26%	NA
Tropical Japonica	504	42.10%	57.70%	0.00%	0.20%	NA
Japonica Intermediate	241	46.10%	53.90%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	57.80%	38.90%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0235128703	T -> DEL	N	N	silent_mutation	Average:44.363; most accessible tissue: Zhenshan97 root, score: 67.648	N	N	N	N
vg0235128703	T -> C	LOC_Os02g57350.1	upstream_gene_variant ; 1971.0bp to feature; MODIFIER	silent_mutation	Average:44.363; most accessible tissue: Zhenshan97 root, score: 67.648	N	N	N	N
vg0235128703	T -> C	LOC_Os02g57360.1	upstream_gene_variant ; 4409.0bp to feature; MODIFIER	silent_mutation	Average:44.363; most accessible tissue: Zhenshan97 root, score: 67.648	N	N	N	N
vg0235128703	T -> C	LOC_Os02g57340.1	downstream_gene_variant ; 1887.0bp to feature; MODIFIER	silent_mutation	Average:44.363; most accessible tissue: Zhenshan97 root, score: 67.648	N	N	N	N
vg0235128703	T -> C	LOC_Os02g57340-LOC_Os02g57350	intergenic_region ; MODIFIER	silent_mutation	Average:44.363; most accessible tissue: Zhenshan97 root, score: 67.648	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0235128703	NA	3.99E-09	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128703	NA	8.40E-08	mr1092_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128703	NA	1.10E-06	mr1097_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128703	NA	9.53E-07	mr1102_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128703	NA	4.54E-07	mr1152_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128703	NA	1.39E-07	mr1154_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128703	8.22E-06	5.21E-07	mr1223_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128703	NA	7.43E-06	mr1239_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128703	8.75E-06	6.10E-06	mr1407_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235128703	NA	4.88E-06	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251