\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235108960:

Variant ID: vg0235108960 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 35108960
Reference Allele: GCGCTAlternative Allele: TCGCT,G
Primary Allele: GCGCTSecondary Allele: TCGCT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAAGCTGTTCCCGGATTTTCTTCTTCAGTTCACCTTCCTTGCGCCTTGCTTCCTGTTCCTCTTCCGCCCGGGCAGTCTCATAATCAGCGCCCGCCGCGC[GCGCT/TCGCT,G]
GCTCTTATCCTTTTCTCATCGAAGTGAAACTCAAATCTGAGCTGGACTTCGTTGATGTTTAGGAGAAACTCTAGCCCAGAAAACCCAATTTCATTTTTTA

Reverse complement sequence

TAAAAAATGAAATTGGGTTTTCTGGGCTAGAGTTTCTCCTAAACATCAACGAAGTCCAGCTCAGATTTGAGTTTCACTTCGATGAGAAAAGGATAAGAGC[AGCGC/AGCGA,C]
GCGCGGCGGGCGCTGATTATGAGACTGCCCGGGCGGAAGAGGAACAGGAAGCAAGGCGCAAGGAAGGTGAACTGAAGAAGAAAATCCGGGAACAGCTTGC

Allele Frequencies:

Populations Population SizeFrequency of GCGCT(primary allele) Frequency of TCGCT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.60% 12.50% 11.21% 16.89% G: 0.83%
All Indica  2759 41.30% 16.70% 16.20% 24.47% G: 1.34%
All Japonica  1512 87.60% 5.40% 2.84% 4.10% G: 0.07%
Aus  269 64.70% 11.90% 6.69% 16.36% G: 0.37%
Indica I  595 8.20% 28.90% 22.02% 40.67% G: 0.17%
Indica II  465 76.60% 3.90% 8.17% 10.54% G: 0.86%
Indica III  913 37.60% 15.30% 19.39% 25.08% G: 2.63%
Indica Intermediate  786 49.70% 16.70% 12.85% 19.72% G: 1.02%
Temperate Japonica  767 98.60% 0.40% 0.65% 0.39% NA
Tropical Japonica  504 67.30% 15.30% 6.75% 10.52% G: 0.20%
Japonica Intermediate  241 95.40% 0.40% 1.66% 2.49% NA
VI/Aromatic  96 77.10% 3.10% 13.54% 6.25% NA
Intermediate  90 63.30% 14.40% 10.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0235108960 GCGCT -> TCGCT LOC_Os02g57305.1 missense_variant ; p.Arg358Ser; MODERATE synonymous_codon Average:82.1; most accessible tissue: Minghui63 flag leaf, score: 95.08 N N N N
vg0235108960 GCGCT -> TCGCT LOC_Os02g57305.1 missense_variant ; p.Arg358Ser; MODERATE nonsynonymous_codon ; R358S Average:82.1; most accessible tissue: Minghui63 flag leaf, score: 95.08 unknown unknown unknown unknown
vg0235108960 GCGCT -> G LOC_Os02g57305.1 frameshift_variant ; p.Ala359fs; HIGH frameshift_variant Average:82.1; most accessible tissue: Minghui63 flag leaf, score: 95.08 N N N N
vg0235108960 GCGCT -> DEL LOC_Os02g57305.1 N frameshift_variant Average:82.1; most accessible tissue: Minghui63 flag leaf, score: 95.08 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0235108960 GCGCT G 0.26 0.28 0.32 0.25 0.26 0.3
vg0235108960 GCGCT TCGCT -0.08 -0.05 -0.05 -0.05 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0235108960 NA 5.48E-09 mr1231 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235108960 NA 5.70E-06 mr1232 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235108960 NA 5.65E-06 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235108960 NA 7.08E-11 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235108960 NA 3.21E-08 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235108960 NA 3.14E-08 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235108960 NA 6.92E-07 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235108960 NA 1.88E-06 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235108960 NA 1.58E-08 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235108960 NA 3.69E-07 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235108960 NA 1.05E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235108960 NA 4.91E-06 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235108960 NA 1.69E-10 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235108960 NA 1.32E-13 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235108960 NA 1.85E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235108960 NA 5.19E-07 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235108960 NA 8.48E-06 mr1931_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235108960 NA 6.01E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251