\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235049174:

Variant ID: vg0235049174 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 35049174
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACACAGATAGCTTAACACTTGCAGGCCAAGTTTGTTAATTAATAATCCATGTCCCATAATAATTGTATTTATAGGATTTGAATTTATCTCAAAATAATT[G/A]
TCAAAATATAGTACTAATTAATGATCTCATTAATCACTTCTCATTCAAATTTCTCCTTATTTTACTCTCAACTATCCTGTACACTCTTACGTAGTACCAT

Reverse complement sequence

ATGGTACTACGTAAGAGTGTACAGGATAGTTGAGAGTAAAATAAGGAGAAATTTGAATGAGAAGTGATTAATGAGATCATTAATTAGTACTATATTTTGA[C/T]
AATTATTTTGAGATAAATTCAAATCCTATAAATACAATTATTATGGGACATGGATTATTAATTAACAAACTTGGCCTGCAAGTGTTAAGCTATCTGTGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.80% 3.30% 15.49% 6.37% NA
All Indica  2759 70.70% 0.30% 20.70% 8.34% NA
All Japonica  1512 90.50% 0.70% 5.82% 2.98% NA
Aus  269 47.20% 24.50% 21.19% 7.06% NA
Indica I  595 51.30% 0.00% 41.34% 7.39% NA
Indica II  465 79.40% 0.90% 14.19% 5.59% NA
Indica III  913 78.10% 0.30% 11.39% 10.19% NA
Indica Intermediate  786 71.60% 0.10% 19.72% 8.52% NA
Temperate Japonica  767 97.80% 0.40% 1.56% 0.26% NA
Tropical Japonica  504 78.00% 0.00% 14.09% 7.94% NA
Japonica Intermediate  241 93.40% 3.30% 2.07% 1.24% NA
VI/Aromatic  96 22.90% 70.80% 6.25% 0.00% NA
Intermediate  90 75.60% 5.60% 11.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0235049174 G -> A LOC_Os02g57210.1 upstream_gene_variant ; 3740.0bp to feature; MODIFIER silent_mutation Average:50.911; most accessible tissue: Callus, score: 75.159 N N N N
vg0235049174 G -> A LOC_Os02g57200.1 downstream_gene_variant ; 2733.0bp to feature; MODIFIER silent_mutation Average:50.911; most accessible tissue: Callus, score: 75.159 N N N N
vg0235049174 G -> A LOC_Os02g57200-LOC_Os02g57210 intergenic_region ; MODIFIER silent_mutation Average:50.911; most accessible tissue: Callus, score: 75.159 N N N N
vg0235049174 G -> DEL N N silent_mutation Average:50.911; most accessible tissue: Callus, score: 75.159 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0235049174 NA 7.04E-09 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235049174 NA 4.08E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235049174 NA 3.51E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235049174 NA 7.82E-06 mr1127_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235049174 NA 3.16E-06 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235049174 NA 7.68E-12 mr1567_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235049174 NA 2.39E-10 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235049174 NA 1.52E-06 mr1735_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251