Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0235049174:

Variant ID: vg0235049174 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 35049174
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACACAGATAGCTTAACACTTGCAGGCCAAGTTTGTTAATTAATAATCCATGTCCCATAATAATTGTATTTATAGGATTTGAATTTATCTCAAAATAATT[G/A]
TCAAAATATAGTACTAATTAATGATCTCATTAATCACTTCTCATTCAAATTTCTCCTTATTTTACTCTCAACTATCCTGTACACTCTTACGTAGTACCAT

Reverse complement sequence

ATGGTACTACGTAAGAGTGTACAGGATAGTTGAGAGTAAAATAAGGAGAAATTTGAATGAGAAGTGATTAATGAGATCATTAATTAGTACTATATTTTGA[C/T]
AATTATTTTGAGATAAATTCAAATCCTATAAATACAATTATTATGGGACATGGATTATTAATTAACAAACTTGGCCTGCAAGTGTTAAGCTATCTGTGTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.80%	3.30%	15.49%	6.37%	NA
All Indica	2759	70.70%	0.30%	20.70%	8.34%	NA
All Japonica	1512	90.50%	0.70%	5.82%	2.98%	NA
Aus	269	47.20%	24.50%	21.19%	7.06%	NA
Indica I	595	51.30%	0.00%	41.34%	7.39%	NA
Indica II	465	79.40%	0.90%	14.19%	5.59%	NA
Indica III	913	78.10%	0.30%	11.39%	10.19%	NA
Indica Intermediate	786	71.60%	0.10%	19.72%	8.52%	NA
Temperate Japonica	767	97.80%	0.40%	1.56%	0.26%	NA
Tropical Japonica	504	78.00%	0.00%	14.09%	7.94%	NA
Japonica Intermediate	241	93.40%	3.30%	2.07%	1.24%	NA
VI/Aromatic	96	22.90%	70.80%	6.25%	0.00%	NA
Intermediate	90	75.60%	5.60%	11.11%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0235049174	G -> A	LOC_Os02g57210.1	upstream_gene_variant ; 3740.0bp to feature; MODIFIER	silent_mutation	Average:50.911; most accessible tissue: Callus, score: 75.159	N	N	N	N
vg0235049174	G -> A	LOC_Os02g57200.1	downstream_gene_variant ; 2733.0bp to feature; MODIFIER	silent_mutation	Average:50.911; most accessible tissue: Callus, score: 75.159	N	N	N	N
vg0235049174	G -> A	LOC_Os02g57200-LOC_Os02g57210	intergenic_region ; MODIFIER	silent_mutation	Average:50.911; most accessible tissue: Callus, score: 75.159	N	N	N	N
vg0235049174	G -> DEL	N	N	silent_mutation	Average:50.911; most accessible tissue: Callus, score: 75.159	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0235049174	NA	7.04E-09	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235049174	NA	4.08E-07	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235049174	NA	3.51E-07	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235049174	NA	7.82E-06	mr1127_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235049174	NA	3.16E-06	mr1169_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235049174	NA	7.68E-12	mr1567_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235049174	NA	2.39E-10	mr1612_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0235049174	NA	1.52E-06	mr1735_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251