\
| Variant ID: vg0235046801 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 35046801 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 236. )
AATGAGGTGTGGTGTTGGTTTGGACTAGTTGGAATGATAACAAAATGAGGGGTTTTTTCACCAAATGATCTAATTGGCCCATTGTTAACGAAAAAAAATC[G/A]
AACACACCGGCCTGGGAGATCTGCTTAGCTCCTGTGCAGGTCCAAAGATTAATGAGATGCGGGCGTGCCAGTCAGTTTAATCCTGCAATTGACAAGATTT
AAATCTTGTCAATTGCAGGATTAAACTGACTGGCACGCCCGCATCTCATTAATCTTTGGACCTGCACAGGAGCTAAGCAGATCTCCCAGGCCGGTGTGTT[C/T]
GATTTTTTTTCGTTAACAATGGGCCAATTAGATCATTTGGTGAAAAAACCCCTCATTTTGTTATCATTCCAACTAGTCCAAACCAACACCACACCTCATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.40% | 16.30% | 0.11% | 0.19% | NA |
| All Indica | 2759 | 79.80% | 19.70% | 0.14% | 0.33% | NA |
| All Japonica | 1512 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 70.60% | 29.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 31.80% | 67.70% | 0.00% | 0.43% | NA |
| Indica III | 913 | 91.50% | 8.20% | 0.11% | 0.22% | NA |
| Indica Intermediate | 786 | 80.20% | 18.80% | 0.38% | 0.64% | NA |
| Temperate Japonica | 767 | 93.60% | 6.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 29.20% | 70.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 12.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0235046801 | G -> A | LOC_Os02g57200.1 | downstream_gene_variant ; 360.0bp to feature; MODIFIER | silent_mutation | Average:62.268; most accessible tissue: Callus, score: 87.268 | N | N | N | N |
| vg0235046801 | G -> A | LOC_Os02g57200-LOC_Os02g57210 | intergenic_region ; MODIFIER | silent_mutation | Average:62.268; most accessible tissue: Callus, score: 87.268 | N | N | N | N |
| vg0235046801 | G -> DEL | N | N | silent_mutation | Average:62.268; most accessible tissue: Callus, score: 87.268 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0235046801 | NA | 2.18E-07 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 1.20E-08 | mr1565 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 7.98E-06 | mr1598 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 3.75E-06 | mr1715 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 1.21E-06 | mr1892 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 5.34E-08 | mr1041_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 6.45E-10 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 2.31E-06 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 5.20E-07 | mr1293_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 6.48E-11 | mr1294_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 9.72E-07 | mr1294_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 2.93E-06 | mr1299_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 1.48E-09 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 1.87E-09 | mr1327_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 1.45E-10 | mr1327_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 2.81E-07 | mr1360_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 5.48E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 1.61E-08 | mr1419_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 3.00E-08 | mr1420_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 8.57E-08 | mr1467_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 2.07E-06 | mr1478_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 2.12E-08 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 4.87E-06 | mr1492_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 7.92E-06 | mr1494_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 1.00E-10 | mr1497_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 5.19E-08 | mr1497_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 9.00E-06 | mr1556_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 4.04E-09 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 1.62E-12 | mr1565_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 1.85E-10 | mr1565_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 9.38E-13 | mr1598_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 1.10E-10 | mr1604_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 7.42E-09 | mr1627_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 1.90E-06 | mr1653_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 2.61E-08 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 1.58E-07 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 6.16E-07 | mr1706_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 9.67E-18 | mr1715_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 5.72E-12 | mr1715_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 9.22E-06 | mr1735_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 2.18E-09 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 1.09E-06 | mr1756_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 4.14E-06 | mr1759_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 8.05E-06 | mr1764_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 6.37E-06 | mr1771_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 1.01E-06 | mr1779_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 5.04E-07 | mr1813_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 4.09E-06 | mr1814_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 1.79E-07 | mr1823_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 2.69E-10 | mr1824_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 3.53E-06 | mr1854_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 2.68E-07 | mr1894_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 4.79E-06 | mr1895_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 1.90E-06 | mr1960_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 9.66E-06 | mr1976_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0235046801 | NA | 7.30E-06 | mr1992_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |