Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0234966943:

Variant ID: vg0234966943 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 34966943
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TTCCTCTCCAAGTCTCTGATTCTCCAAGTAGATCCTATCCCTGCACCTCTCCTCCAACTCCGGCGCTCTCCAGCACTAATCTTCCCGGCGGGCCAACGGC[G/A]
GCGGCCGTACGATCCGCCTCTGCCGGCGTCTTCTCTACCGCTGCCGATCCATTTCAAGACCTAATTATCTACCTCATGGAATTTGTTGGTTACTGAGGAC

Reverse complement sequence

GTCCTCAGTAACCAACAAATTCCATGAGGTAGATAATTAGGTCTTGAAATGGATCGGCAGCGGTAGAGAAGACGCCGGCAGAGGCGGATCGTACGGCCGC[C/T]
GCCGTTGGCCCGCCGGGAAGATTAGTGCTGGAGAGCGCCGGAGTTGGAGGAGAGGTGCAGGGATAGGATCTACTTGGAGAATCAGAGACTTGGAGAGGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.10% 43.30% 0.61% 0.00% NA
All Indica  2759 40.00% 59.20% 0.83% 0.00% NA
All Japonica  1512 85.00% 14.70% 0.26% 0.00% NA
Aus  269 46.10% 53.90% 0.00% 0.00% NA
Indica I  595 21.70% 78.20% 0.17% 0.00% NA
Indica II  465 75.50% 23.00% 1.51% 0.00% NA
Indica III  913 28.70% 70.90% 0.44% 0.00% NA
Indica Intermediate  786 46.10% 52.50% 1.40% 0.00% NA
Temperate Japonica  767 97.80% 1.80% 0.39% 0.00% NA
Tropical Japonica  504 60.90% 38.90% 0.20% 0.00% NA
Japonica Intermediate  241 94.60% 5.40% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 11.50% 1.04% 0.00% NA
Intermediate  90 60.00% 38.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0234966943 G -> A LOC_Os02g57100.1 upstream_gene_variant ; 341.0bp to feature; MODIFIER silent_mutation Average:93.972; most accessible tissue: Zhenshan97 young leaf, score: 96.311 N N N N
vg0234966943 G -> A LOC_Os02g57110.1 downstream_gene_variant ; 654.0bp to feature; MODIFIER silent_mutation Average:93.972; most accessible tissue: Zhenshan97 young leaf, score: 96.311 N N N N
vg0234966943 G -> A LOC_Os02g57110.2 downstream_gene_variant ; 656.0bp to feature; MODIFIER silent_mutation Average:93.972; most accessible tissue: Zhenshan97 young leaf, score: 96.311 N N N N
vg0234966943 G -> A LOC_Os02g57100-LOC_Os02g57110 intergenic_region ; MODIFIER silent_mutation Average:93.972; most accessible tissue: Zhenshan97 young leaf, score: 96.311 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0234966943 G A -0.03 -0.04 -0.03 -0.03 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0234966943 NA 1.16E-07 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234966943 NA 9.81E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234966943 NA 1.89E-06 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234966943 NA 9.06E-08 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234966943 NA 8.39E-09 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234966943 1.27E-06 2.42E-09 mr1528_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234966943 NA 4.13E-12 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234966943 NA 1.09E-09 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234966943 NA 4.89E-08 mr1758_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234966943 NA 1.30E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251